EMAIL THIS PAGE TO A FRIEND

IRF2BPL

interferon regulatory factor 2 binding protein-like

125 Gene Product Result for
Synonyms: C14orf4 EAP1
UniProtKB ID: Q9H1B7, Q8NDQ2, Q96JG2, Q9H3I7
Gene ID:
Human(64207) Summary: This gene encodes a transcription factor that may play a role in regulating female reproductive function. [provided by RefSeq, Jun 2012]
Mouse(238330) interferon regulatory factor 2 binding protein-like
Rat(314329) interferon regulatory factor 2 binding protein-like
Zebrafish(324723) interferon regulatory factor 2 binding protein-like
cow(613845) interferon regulatory factor 2 binding protein-like
domestic cat(101085047) interferon regulatory factor 2 binding protein-like
dog(100685860) interferon regulatory factor 2 binding protein-like
domestic guinea pig(100716834) interferon regulatory factor 2 binding protein-like
naked mole-rat(101709555) interferon regulatory factor 2 binding protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024496 Rosetta Predictions human pricing
NM_001012470 Rosetta Predictions rat pricing
NM_145836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108184 predicted 2052
2 SASI_Hs01_00108186 predicted 2125
3 SASI_Hs01_00108187 predicted 2058
4 SASI_Hs01_00108188 predicted 2130
5 SASI_Hs01_00108189 predicted 2139
6 SASI_Hs01_00108190 predicted 2109
7 SASI_Hs02_00356765 predicted 2193
8 SASI_Hs02_00356766 predicted 2188
9 SASI_Hs02_00356767 predicted 3113
10 SASI_Hs02_00356768 predicted 3074
11 SASI_Hs01_00108183 predicted 3049
12 SASI_Hs01_00108185 predicted 3053
13 SASI_Hs01_00108191 predicted 3063
14 SASI_Hs01_00108192 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052770 predicted 1118
2 SASI_Rn01_00052771 predicted 1836
3 SASI_Rn01_00052772 predicted 2101
4 SASI_Rn01_00052773 predicted 1875
5 SASI_Rn01_00052775 predicted 1125
6 SASI_Rn01_00052776 predicted 2130
7 SASI_Rn02_00200576 predicted 2121
8 SASI_Rn01_00052777 predicted 898
9 SASI_Rn01_00052778 predicted 1165
10 SASI_Rn01_00052779 predicted 952
11 SASI_Rn01_00052774 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341311 predicted 2511
2 SASI_Mm01_00083276 predicted 1769
3 SASI_Mm01_00083277 predicted 3390
4 SASI_Mm01_00083278 predicted 2098
5 SASI_Mm02_00341312 predicted 2728
6 SASI_Mm01_00083284 predicted 1633
7 SASI_Mm02_00341313 predicted 3319
8 SASI_Mm02_00341314 predicted 2177
9 SASI_Mm02_00341315 predicted 2741
10 SASI_Mm02_00341316 predicted 2340
11 SASI_Mm01_00083275 predicted 3331
12 SASI_Mm01_00083279 predicted 3423
13 SASI_Mm01_00083280 predicted 3446
14 SASI_Mm01_00083281 predicted 3179
15 SASI_Mm01_00083282 predicted 3441
16 SASI_Mm01_00083283 predicted 3369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024496
IRF2BPL MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2 binding protein-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024496.2-3551s21c1
Sequence:CCGGGCATCATATCGTTAGCATTTACTCGAGTAAATGCTAACGATATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024496.2-3588s21c1
Sequence:CCGGTTGCCTAGGTACAGAATTAATCTCGAGATTAATTCTGTACCTAGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024496.2-3232s21c1
Sequence:CCGGGCGAAATCGCGACTATCTTAGCTCGAGCTAAGATAGTCGCGATTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2132s1c1
Sequence:CCGGCGGCATGGACTACGAATTGAACTCGAGTTCAATTCGTAGTCCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-1275s1c1
Sequence:CCGGCAACAGCTCAACCACGTTGATCTCGAGATCAACGTGGTTGAGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2775s1c1
Sequence:CCGGGCTCTCATGTCGGTGGCAGATCTCGAGATCTGCCACCGACATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-3206s1c1
Sequence:CCGGGAATGTACCTTGGGCCTTCATCTCGAGATGAAGGCCCAAGGTACATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2141s1c1
Sequence:CCGGCTACGAATTGAAGCTGTTCATCTCGAGATGAACAGCTTCAATTCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024496
IRF2BPL MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2 binding protein-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024496.2-3551s21c1
Sequence:CCGGGCATCATATCGTTAGCATTTACTCGAGTAAATGCTAACGATATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024496.2-3588s21c1
Sequence:CCGGTTGCCTAGGTACAGAATTAATCTCGAGATTAATTCTGTACCTAGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024496.2-3232s21c1
Sequence:CCGGGCGAAATCGCGACTATCTTAGCTCGAGCTAAGATAGTCGCGATTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2132s1c1
Sequence:CCGGCGGCATGGACTACGAATTGAACTCGAGTTCAATTCGTAGTCCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-1275s1c1
Sequence:CCGGCAACAGCTCAACCACGTTGATCTCGAGATCAACGTGGTTGAGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2775s1c1
Sequence:CCGGGCTCTCATGTCGGTGGCAGATCTCGAGATCTGCCACCGACATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-3206s1c1
Sequence:CCGGGAATGTACCTTGGGCCTTCATCTCGAGATGAAGGCCCAAGGTACATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2141s1c1
Sequence:CCGGCTACGAATTGAAGCTGTTCATCTCGAGATGAACAGCTTCAATTCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024496
IRF2BPL MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2 binding protein-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024496.2-3551s21c1
Sequence:CCGGGCATCATATCGTTAGCATTTACTCGAGTAAATGCTAACGATATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024496.2-3588s21c1
Sequence:CCGGTTGCCTAGGTACAGAATTAATCTCGAGATTAATTCTGTACCTAGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024496.2-3232s21c1
Sequence:CCGGGCGAAATCGCGACTATCTTAGCTCGAGCTAAGATAGTCGCGATTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2132s1c1
Sequence:CCGGCGGCATGGACTACGAATTGAACTCGAGTTCAATTCGTAGTCCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-1275s1c1
Sequence:CCGGCAACAGCTCAACCACGTTGATCTCGAGATCAACGTGGTTGAGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2775s1c1
Sequence:CCGGGCTCTCATGTCGGTGGCAGATCTCGAGATCTGCCACCGACATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-3206s1c1
Sequence:CCGGGAATGTACCTTGGGCCTTCATCTCGAGATGAAGGCCCAAGGTACATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024496.2-2141s1c1
Sequence:CCGGCTACGAATTGAAGCTGTTCATCTCGAGATGAACAGCTTCAATTCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145836
IRF2BPL MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 2 binding protein-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000041138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-3071s1c1
Sequence:CCGGCCCTTGTTCTAGAGAGAGTATCTCGAGATACTCTCTCTAGAACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-2177s1c1
Sequence:CCGGCCAGGATTGCATGAAGGACTTCTCGAGAAGTCCTTCATGCAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-1759s1c1
Sequence:CCGGCGGGTGTGTCAGCCACTGTATCTCGAGATACAGTGGCTGACACACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-2100s1c1
Sequence:CCGGCTGAAGCTGTTCATTGAGTATCTCGAGATACTCAATGAACAGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145836
IRF2BPL MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 2 binding protein-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000041138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-3071s1c1
Sequence:CCGGCCCTTGTTCTAGAGAGAGTATCTCGAGATACTCTCTCTAGAACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-2177s1c1
Sequence:CCGGCCAGGATTGCATGAAGGACTTCTCGAGAAGTCCTTCATGCAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-1759s1c1
Sequence:CCGGCGGGTGTGTCAGCCACTGTATCTCGAGATACAGTGGCTGACACACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-2100s1c1
Sequence:CCGGCTGAAGCTGTTCATTGAGTATCTCGAGATACTCAATGAACAGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145836
IRF2BPL MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 2 binding protein-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000041138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-3071s1c1
Sequence:CCGGCCCTTGTTCTAGAGAGAGTATCTCGAGATACTCTCTCTAGAACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-2177s1c1
Sequence:CCGGCCAGGATTGCATGAAGGACTTCTCGAGAAGTCCTTCATGCAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-1759s1c1
Sequence:CCGGCGGGTGTGTCAGCCACTGTATCTCGAGATACAGTGGCTGACACACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145836.1-2100s1c1
Sequence:CCGGCTGAAGCTGTTCATTGAGTATCTCGAGATACTCAATGAACAGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)