EMAIL THIS PAGE TO A FRIEND

IRF4

interferon regulatory factor 4

104 Gene Product Result for
Synonyms: LSIRF MUM1 NF-EM5
UniProtKB ID: Q15306, Q5VUI7, Q99660
Gene ID:
Human(3662) Summary: The protein encoded by this gene belongs to the IRF (interferon regulatory factor) family of transcription factors, characterized by an unique tryptophan pentad repeat DNA-binding domain. The IRFs are important in the regulation of interferons in response to infection by virus, and in the regulation of interferon-inducible genes. This family member is lymphocyte specific and negatively regulates Toll-like-receptor (TLR) signaling that is central to the activation of innate and adaptive immune systems. A chromosomal translocation involving this gene and the IgH locus, t(6;14)(p25;q32), may be a cause of multiple myeloma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2010]
Mouse(16364) interferon regulatory factor 4
Rat(291100) interferon regulatory factor 4
chicken(374179) interferon regulatory factor 4
domestic cat(101089438) interferon regulatory factor 4
cow(506141) interferon regulatory factor 4
Horse(100068881) interferon regulatory factor 4
Horse(100049827) interferon regulatory factor 4
domestic guinea pig(100719564) interferon regulatory factor 4
naked mole-rat(101705637) interferon regulatory factor 4
sheep(101111234) interferon regulatory factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502031 Anti-IRF4 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1411959 ANTI-IRF4 antibody produced in mouse clone 3A10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412642 ANTI-IRF4 antibody produced in mouse clone 3C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA002038 Anti-IRF4 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
AV38154 Anti-IRF4 antibody produced in rabbit affinity isolated antibody human, rat, horse, guinea pig, mouse, bovine
immunohistochemistry, western blot pricing
AV32669 Anti-IRF4 antibody produced in rabbit IgG fraction of antiserum pig, bovine, guinea pig, rabbit, rat, zebrafish, mouse, human, canine, horse
western blot pricing
SAB2101176 Anti-IRF4 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse
western blot pricing
HPA002698 Anti-IRF4 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4501566 Anti-IRF4 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB5500147 Anti-MUM1/IRF4 antibody, Rabbit monoclonal clone SP114, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
WH0003662M2 Monoclonal Anti-IRF4 antibody produced in mouse clone 2F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403990 Monoclonal Anti-IRF4, (C-terminal) antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002460 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062171 MISSION® esiRNA esiRNA human IRF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002460 Rosetta Predictions human pricing
NM_001106108 Rosetta Predictions rat pricing
NM_013674 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125485 predicted 320
2 SASI_Hs01_00125486 predicted 935
3 SASI_Hs02_00333880 predicted 880
4 SASI_Hs01_00125487 predicted 860
5 SASI_Hs01_00125488 predicted 657
6 SASI_Hs01_00125489 predicted 575
7 SASI_Hs01_00125491 predicted 317
8 SASI_Hs01_00125493 predicted 408
9 SASI_Hs02_00333881 predicted 935
10 SASI_Hs02_00333882 predicted 1936
11 SASI_Hs01_00125484 predicted 1183
12 SASI_Hs01_00125490 predicted 1239
13 SASI_Hs01_00125492 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215702 predicted 1135
2 SASI_Rn02_00215703 predicted 401
3 SASI_Rn02_00215704 predicted 1385
4 SASI_Rn02_00215705 predicted 1358
5 SASI_Rn02_00215706 predicted 616
6 SASI_Rn02_00215707 predicted 817
7 SASI_Rn02_00215708 predicted 461
8 SASI_Rn02_00215709 predicted 904
9 SASI_Rn02_00215710 predicted 1191
10 SASI_Rn02_00215711 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156907 predicted 1391
2 SASI_Mm01_00156908 predicted 424
3 SASI_Mm01_00156909 predicted 1421
4 SASI_Mm02_00322534 predicted 380
5 SASI_Mm01_00156910 predicted 1294
6 SASI_Mm02_00322535 predicted 1104
7 SASI_Mm01_00156911 predicted 1140
8 SASI_Mm01_00156912 predicted 409
9 SASI_Mm01_00156913 predicted 1219
10 SASI_Mm01_00156914 predicted 1135
11 SASI_Mm01_00156915 predicted 478
12 SASI_Mm01_00156916 predicted 1366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013674
IRF4 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-1298s1c1
Sequence:CCGGGCCAGACAACTGTATTACTTTCTCGAGAAAGTAATACAGTTGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013674.1-4378s1c1
Sequence:CCGGCCAGAGTATATTGAAGTAGAACTCGAGTTCTACTTCAATATACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-559s1c1
Sequence:CCGGCCAGCAGGTTCATAACTACATCTCGAGATGTAGTTATGAACCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-371s1c1
Sequence:CCGGCTGAACAAGAGCAATGACTTTCTCGAGAAAGTCATTGCTCTTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-779s1c1
Sequence:CCGGCCAAGCATAAGGTCTGCTGAACTCGAGTTCAGCAGACCTTATGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013674.1-2822s21c1
Sequence:CCGGCGAATCCTCCTTGCTAGTATTCTCGAGAATACTAGCAAGGAGGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1366s21c1
Sequence:CCGGACACGTTACCACTCCAGATTACTCGAGTAATCTGGAGTGGTAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1295s21c1
Sequence:CCGGCTAGCCAGACAACTGTATTACCTCGAGGTAATACAGTTGTCTGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1105s21c1
Sequence:CCGGTCGGCCCAACAAGCTAGAAAGCTCGAGCTTTCTAGCTTGTTGGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1025s21c1
Sequence:CCGGATGGCTCCAGATGGGCTTTATCTCGAGATAAAGCCCATCTGGAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013674
IRF4 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-1298s1c1
Sequence:CCGGGCCAGACAACTGTATTACTTTCTCGAGAAAGTAATACAGTTGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013674.1-4378s1c1
Sequence:CCGGCCAGAGTATATTGAAGTAGAACTCGAGTTCTACTTCAATATACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-559s1c1
Sequence:CCGGCCAGCAGGTTCATAACTACATCTCGAGATGTAGTTATGAACCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-371s1c1
Sequence:CCGGCTGAACAAGAGCAATGACTTTCTCGAGAAAGTCATTGCTCTTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-779s1c1
Sequence:CCGGCCAAGCATAAGGTCTGCTGAACTCGAGTTCAGCAGACCTTATGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013674.1-2822s21c1
Sequence:CCGGCGAATCCTCCTTGCTAGTATTCTCGAGAATACTAGCAAGGAGGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1366s21c1
Sequence:CCGGACACGTTACCACTCCAGATTACTCGAGTAATCTGGAGTGGTAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1295s21c1
Sequence:CCGGCTAGCCAGACAACTGTATTACCTCGAGGTAATACAGTTGTCTGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1105s21c1
Sequence:CCGGTCGGCCCAACAAGCTAGAAAGCTCGAGCTTTCTAGCTTGTTGGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1025s21c1
Sequence:CCGGATGGCTCCAGATGGGCTTTATCTCGAGATAAAGCCCATCTGGAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013674
IRF4 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-1298s1c1
Sequence:CCGGGCCAGACAACTGTATTACTTTCTCGAGAAAGTAATACAGTTGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013674.1-4378s1c1
Sequence:CCGGCCAGAGTATATTGAAGTAGAACTCGAGTTCTACTTCAATATACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-559s1c1
Sequence:CCGGCCAGCAGGTTCATAACTACATCTCGAGATGTAGTTATGAACCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-371s1c1
Sequence:CCGGCTGAACAAGAGCAATGACTTTCTCGAGAAAGTCATTGCTCTTGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013674.1-779s1c1
Sequence:CCGGCCAAGCATAAGGTCTGCTGAACTCGAGTTCAGCAGACCTTATGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013674.1-2822s21c1
Sequence:CCGGCGAATCCTCCTTGCTAGTATTCTCGAGAATACTAGCAAGGAGGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1366s21c1
Sequence:CCGGACACGTTACCACTCCAGATTACTCGAGTAATCTGGAGTGGTAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1295s21c1
Sequence:CCGGCTAGCCAGACAACTGTATTACCTCGAGGTAATACAGTTGTCTGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1105s21c1
Sequence:CCGGTCGGCCCAACAAGCTAGAAAGCTCGAGCTTTCTAGCTTGTTGGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013674.1-1025s21c1
Sequence:CCGGATGGCTCCAGATGGGCTTTATCTCGAGATAAAGCCCATCTGGAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002460
IRF4 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-1439s1c1
Sequence:CCGGGCCATTCCTCTATTCAAGAATCTCGAGATTCTTGAATAGAGGAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-1176s1c1
Sequence:CCGGGCTCTTTGACACACAGCAGTTCTCGAGAACTGCTGTGTGTCAAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-400s1c1
Sequence:CCGGTGCGCTTTGAACAAGAGCAATCTCGAGATTGCTCTTGTTCAAAGCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002460.2-1938s21c1
Sequence:CCGGTTTACTGAAATGCGCTCTTTACTCGAGTAAAGAGCGCATTTCAGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002460.2-1706s21c1
Sequence:CCGGCTTTAGTGAAAGCGTCCAATTCTCGAGAATTGGACGCTTTCACTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002460
IRF4 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-1439s1c1
Sequence:CCGGGCCATTCCTCTATTCAAGAATCTCGAGATTCTTGAATAGAGGAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-1176s1c1
Sequence:CCGGGCTCTTTGACACACAGCAGTTCTCGAGAACTGCTGTGTGTCAAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-400s1c1
Sequence:CCGGTGCGCTTTGAACAAGAGCAATCTCGAGATTGCTCTTGTTCAAAGCGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002460.2-1938s21c1
Sequence:CCGGTTTACTGAAATGCGCTCTTTACTCGAGTAAAGAGCGCATTTCAGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002460.2-1706s21c1
Sequence:CCGGCTTTAGTGAAAGCGTCCAATTCTCGAGAATTGGACGCTTTCACTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002460
IRF4 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-1439s1c1
Sequence:CCGGGCCATTCCTCTATTCAAGAATCTCGAGATTCTTGAATAGAGGAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-1176s1c1
Sequence:CCGGGCTCTTTGACACACAGCAGTTCTCGAGAACTGCTGTGTGTCAAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002460.1-400s1c1
Sequence:CCGGTGCGCTTTGAACAAGAGCAATCTCGAGATTGCTCTTGTTCAAAGCGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002460.2-1938s21c1
Sequence:CCGGTTTACTGAAATGCGCTCTTTACTCGAGTAAAGAGCGCATTTCAGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002460.2-1706s21c1
Sequence:CCGGCTTTAGTGAAAGCGTCCAATTCTCGAGAATTGGACGCTTTCACTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)