EMAIL THIS PAGE TO A FRIEND

IRF5

interferon regulatory factor 5

122 Gene Product Result for
Synonyms: SLEB10
Gene ID:
Human(3663) Summary: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Multiple transcript variants encoding different isoforms have been found for this gene, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. [provided by RefSeq, Mar 2010]
Mouse(27056) interferon regulatory factor 5
Rat(296953) interferon regulatory factor 5
Zebrafish(405811) interferon regulatory factor 5
chicken(430409) interferon regulatory factor 5
domestic cat(101082480) interferon regulatory factor 5
cow(615340) interferon regulatory factor 5
Horse(100071786) interferon regulatory factor 5
dog(482264) interferon regulatory factor 5
sheep(101105408) interferon regulatory factor 5
Domestic Rabbit(100350244) interferon regulatory factor 5
domestic guinea pig(100731125) interferon regulatory factor 5
naked mole-rat(101713015) interferon regulatory factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100114 Anti-IRF5 (101-115) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100115 Anti-IRF5 (456-470) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV37180 Anti-IRF5 (AB1) antibody produced in rabbit affinity isolated antibody mouse, rat
western blot pricing
AV38131 Anti-IRF5 (AB2) antibody produced in rabbit IgG fraction of antiserum horse, mouse, bovine, rabbit, human, guinea pig, rat, canine
western blot pricing
SAB2500544 Anti-IRF5 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SAB1412038 ANTI-IRF5 antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1412219 ANTI-IRF5 antibody produced in mouse clone 3C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2103921 Anti-IRF5 antibody produced in rabbit affinity isolated antibody , rabbit, guinea pig, pig, horse, canine, human, bovine, rat, zebrafish, mouse
western blot pricing
HPA046700 Anti-IRF5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB1403991 Monoclonal Anti-IRF5, (C-terminal) antibody produced in mouse clone 2D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002200 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098627 Rosetta Predictions human pricing
NM_001098628 Rosetta Predictions human pricing
NM_001098629 Rosetta Predictions human pricing
NM_001098630 Rosetta Predictions human pricing
NM_001098631 Rosetta Predictions human pricing
NM_002200 Rosetta Predictions human pricing
NM_032643 Rosetta Predictions human pricing
NM_001106586 Rosetta Predictions rat pricing
NM_012057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319571 predicted 1263
2 SASI_Hs02_00319572 predicted 1461
3 SASI_Hs02_00319573 predicted 1402
4 SASI_Hs02_00319574 predicted 1923
5 SASI_Hs02_00319575 predicted 1505
6 SASI_Hs02_00319576 predicted 1679
7 SASI_Hs02_00319577 predicted 2078
8 SASI_Hs02_00319578 predicted 1753
9 SASI_Hs02_00319579 predicted 1445
10 SASI_Hs02_00319580 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319581 predicted 1215
2 SASI_Hs02_00319582 predicted 1413
3 SASI_Hs02_00319583 predicted 1354
4 SASI_Hs02_00319584 predicted 1871
5 SASI_Hs02_00319585 predicted 1453
6 SASI_Hs02_00319586 predicted 1632
7 SASI_Hs02_00319587 predicted 2034
8 SASI_Hs02_00319588 predicted 1703
9 SASI_Hs02_00319589 predicted 1399
10 SASI_Hs02_00319590 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319591 predicted 1297
2 SASI_Hs02_00319592 predicted 1487
3 SASI_Hs02_00319593 predicted 1436
4 SASI_Hs02_00319594 predicted 1946
5 SASI_Hs02_00319595 predicted 1531
6 SASI_Hs02_00319596 predicted 1704
7 SASI_Hs02_00319597 predicted 2108
8 SASI_Hs02_00319598 predicted 1778
9 SASI_Hs02_00319599 predicted 1481
10 SASI_Hs02_00319600 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319601 predicted 1252
2 SASI_Hs02_00319602 predicted 1441
3 SASI_Hs02_00319603 predicted 1385
4 SASI_Hs02_00319604 predicted 1900
5 SASI_Hs02_00319605 predicted 1482
6 SASI_Hs02_00319606 predicted 1659
7 SASI_Hs02_00319607 predicted 2062
8 SASI_Hs02_00319608 predicted 1726
9 SASI_Hs02_00319609 predicted 1433
10 SASI_Hs02_00319610 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319611 predicted 1134
2 SASI_Hs02_00319612 predicted 1327
3 SASI_Hs02_00319613 predicted 1274
4 SASI_Hs02_00319614 predicted 1787
5 SASI_Hs02_00319615 predicted 1370
6 SASI_Hs02_00319616 predicted 1553
7 SASI_Hs02_00319617 predicted 1954
8 SASI_Hs02_00319618 predicted 1623
9 SASI_Hs02_00319619 predicted 1316
10 SASI_Hs02_00319620 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152009 predicted 1270
2 SASI_Hs01_00152010 predicted 1460
3 SASI_Hs01_00152011 predicted 1400
4 SASI_Hs01_00152012 predicted 1923
5 SASI_Hs01_00152013 predicted 1497
6 SASI_Hs01_00152014 predicted 1675
7 SASI_Hs01_00152015 predicted 2083
8 SASI_Hs01_00152017 predicted 1752
9 SASI_Hs02_00333422 predicted 1445
10 SASI_Hs01_00152018 predicted 375
11 SASI_Hs01_00152016 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075909 predicted 1169
2 SASI_Hs01_00075910 predicted 1356
3 SASI_Hs01_00075911 predicted 1299
4 SASI_Hs01_00075912 predicted 1823
5 SASI_Hs01_00075913 predicted 1401
6 SASI_Hs01_00075914 predicted 1581
7 SASI_Hs01_00075915 predicted 1981
8 SASI_Hs01_00075917 predicted 1652
9 SASI_Hs02_00360198 predicted 1349
10 SASI_Hs01_00075918 predicted 298
11 SASI_Hs01_00075916 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220408 predicted 373
2 SASI_Rn02_00220409 predicted 425
3 SASI_Rn02_00220410 predicted 818
4 SASI_Rn02_00220411 predicted 1586
5 SASI_Rn02_00220412 predicted 1413
6 SASI_Rn02_00220413 predicted 1001
7 SASI_Rn02_00220414 predicted 1101
8 SASI_Rn02_00220415 predicted 1176
9 SASI_Rn02_00220416 predicted 1168
10 SASI_Rn02_00220417 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173326 predicted 1820
2 SASI_Mm01_00173327 predicted 385
3 SASI_Mm01_00173328 predicted 1405
4 SASI_Mm01_00173329 predicted 339
5 SASI_Mm02_00322036 predicted 1150
6 SASI_Mm01_00173330 predicted 967
7 SASI_Mm01_00173331 predicted 1380
8 SASI_Mm01_00173332 predicted 781
9 SASI_Mm01_00173333 predicted 1672
10 SASI_Mm01_00173334 predicted 1537
11 SASI_Mm01_00173335 predicted 1421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002200
VALIDATED
IRF5 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1492s21c1
Sequence:CCGGAGACCGCATGGTGGAGCAATTCTCGAGAATTGCTCCACCATGCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1124s21c1
Sequence:CCGGCTACAGGGCCAGGACCTTTATCTCGAGATAAAGGTCCTGGCCCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1616s21c1
Sequence:CCGGCACCCAGCTGGCATGCAATAACTCGAGTTATTGCATGCCAGCTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002200.3-1453s21c1
Sequence:CCGGTGATAGTATCCGGCTACAGATCTCGAGATCTGTAGCCGGATACTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1903s21c1
Sequence:CCGGCCTAGCTGTATAGGAGGAATTCTCGAGAATTCCTCCTATACAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-1903s1c1
Sequence:CCGGCCTAGCTGTATAGGAGGAATTCTCGAGAATTCCTCCTATACAGCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-1453s1c1
Sequence:CCGGTGATAGTATCCGGCTACAGATCTCGAGATCTGTAGCCGGATACTATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002200.3-400s1c1
Sequence:CCGGCCTTAACAAGAGCCGGGACTTCTCGAGAAGTCCCGGCTCTTGTTAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-621s1c1
Sequence:CCGGCCCACATGACACCCTATTCTTCTCGAGAAGAATAGGGTGTCATGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-295s1c1
Sequence:CCGGCGGAGATAACACCATCTTCAACTCGAGTTGAAGATGGTGTTATCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002200
VALIDATED
IRF5 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1492s21c1
Sequence:CCGGAGACCGCATGGTGGAGCAATTCTCGAGAATTGCTCCACCATGCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1124s21c1
Sequence:CCGGCTACAGGGCCAGGACCTTTATCTCGAGATAAAGGTCCTGGCCCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1616s21c1
Sequence:CCGGCACCCAGCTGGCATGCAATAACTCGAGTTATTGCATGCCAGCTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002200.3-1453s21c1
Sequence:CCGGTGATAGTATCCGGCTACAGATCTCGAGATCTGTAGCCGGATACTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1903s21c1
Sequence:CCGGCCTAGCTGTATAGGAGGAATTCTCGAGAATTCCTCCTATACAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-1903s1c1
Sequence:CCGGCCTAGCTGTATAGGAGGAATTCTCGAGAATTCCTCCTATACAGCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-1453s1c1
Sequence:CCGGTGATAGTATCCGGCTACAGATCTCGAGATCTGTAGCCGGATACTATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002200.3-400s1c1
Sequence:CCGGCCTTAACAAGAGCCGGGACTTCTCGAGAAGTCCCGGCTCTTGTTAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-621s1c1
Sequence:CCGGCCCACATGACACCCTATTCTTCTCGAGAAGAATAGGGTGTCATGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-295s1c1
Sequence:CCGGCGGAGATAACACCATCTTCAACTCGAGTTGAAGATGGTGTTATCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002200
VALIDATED
IRF5 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1492s21c1
Sequence:CCGGAGACCGCATGGTGGAGCAATTCTCGAGAATTGCTCCACCATGCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1124s21c1
Sequence:CCGGCTACAGGGCCAGGACCTTTATCTCGAGATAAAGGTCCTGGCCCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1616s21c1
Sequence:CCGGCACCCAGCTGGCATGCAATAACTCGAGTTATTGCATGCCAGCTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002200.3-1453s21c1
Sequence:CCGGTGATAGTATCCGGCTACAGATCTCGAGATCTGTAGCCGGATACTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002200.3-1903s21c1
Sequence:CCGGCCTAGCTGTATAGGAGGAATTCTCGAGAATTCCTCCTATACAGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-1903s1c1
Sequence:CCGGCCTAGCTGTATAGGAGGAATTCTCGAGAATTCCTCCTATACAGCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-1453s1c1
Sequence:CCGGTGATAGTATCCGGCTACAGATCTCGAGATCTGTAGCCGGATACTATCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002200.3-400s1c1
Sequence:CCGGCCTTAACAAGAGCCGGGACTTCTCGAGAAGTCCCGGCTCTTGTTAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-621s1c1
Sequence:CCGGCCCACATGACACCCTATTCTTCTCGAGAAGAATAGGGTGTCATGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_002200.3-295s1c1
Sequence:CCGGCGGAGATAACACCATCTTCAACTCGAGTTGAAGATGGTGTTATCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012057
VALIDATED
IRF5 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1407s21c1
Sequence:CCGGCACATGGTAGAGCAGTTTAAACTCGAGTTTAAACTGCTCTACCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1528s21c1
Sequence:CCGGACCCAGTTGGCATGCAATAATCTCGAGATTATTGCATGCCAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1831s21c1
Sequence:CCGGTAGTACCACGGAGTCCAATTACTCGAGTAATTGGACTCCGTGGTACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1196s21c1
Sequence:CCGGCCAGAAGGGCCAGACTAATACCTCGAGGTATTAGTCTGGCCCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-440s21c1
Sequence:CCGGGAGCCAACCCACTGATGATTACTCGAGTAATCATCAGTGGGTTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-1928s1c1
Sequence:CCGGGCAGAGAATAACCCTGATTTACTCGAGTAAATCAGGGTTATTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-1406s1c1
Sequence:CCGGCCACATGGTAGAGCAGTTTAACTCGAGTTAAACTGCTCTACCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-558s1c1
Sequence:CCGGGCACCCTATTCCTTACCCAAACTCGAGTTTGGGTAAGGAATAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-977s1c1
Sequence:CCGGGCAGCGTTTCTATACGAACCACTCGAGTGGTTCGTATAGAAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-561s1c1
Sequence:CCGGCCCTATTCCTTACCCAAAGAACTCGAGTTCTTTGGGTAAGGAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012057
VALIDATED
IRF5 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1407s21c1
Sequence:CCGGCACATGGTAGAGCAGTTTAAACTCGAGTTTAAACTGCTCTACCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1528s21c1
Sequence:CCGGACCCAGTTGGCATGCAATAATCTCGAGATTATTGCATGCCAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1831s21c1
Sequence:CCGGTAGTACCACGGAGTCCAATTACTCGAGTAATTGGACTCCGTGGTACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1196s21c1
Sequence:CCGGCCAGAAGGGCCAGACTAATACCTCGAGGTATTAGTCTGGCCCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-440s21c1
Sequence:CCGGGAGCCAACCCACTGATGATTACTCGAGTAATCATCAGTGGGTTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-1928s1c1
Sequence:CCGGGCAGAGAATAACCCTGATTTACTCGAGTAAATCAGGGTTATTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-1406s1c1
Sequence:CCGGCCACATGGTAGAGCAGTTTAACTCGAGTTAAACTGCTCTACCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-558s1c1
Sequence:CCGGGCACCCTATTCCTTACCCAAACTCGAGTTTGGGTAAGGAATAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-977s1c1
Sequence:CCGGGCAGCGTTTCTATACGAACCACTCGAGTGGTTCGTATAGAAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-561s1c1
Sequence:CCGGCCCTATTCCTTACCCAAAGAACTCGAGTTCTTTGGGTAAGGAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012057
VALIDATED
IRF5 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1407s21c1
Sequence:CCGGCACATGGTAGAGCAGTTTAAACTCGAGTTTAAACTGCTCTACCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1528s21c1
Sequence:CCGGACCCAGTTGGCATGCAATAATCTCGAGATTATTGCATGCCAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1831s21c1
Sequence:CCGGTAGTACCACGGAGTCCAATTACTCGAGTAATTGGACTCCGTGGTACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-1196s21c1
Sequence:CCGGCCAGAAGGGCCAGACTAATACCTCGAGGTATTAGTCTGGCCCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012057.3-440s21c1
Sequence:CCGGGAGCCAACCCACTGATGATTACTCGAGTAATCATCAGTGGGTTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-1928s1c1
Sequence:CCGGGCAGAGAATAACCCTGATTTACTCGAGTAAATCAGGGTTATTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-1406s1c1
Sequence:CCGGCCACATGGTAGAGCAGTTTAACTCGAGTTAAACTGCTCTACCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-558s1c1
Sequence:CCGGGCACCCTATTCCTTACCCAAACTCGAGTTTGGGTAAGGAATAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-977s1c1
Sequence:CCGGGCAGCGTTTCTATACGAACCACTCGAGTGGTTCGTATAGAAACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012057.1-561s1c1
Sequence:CCGGCCCTATTCCTTACCCAAAGAACTCGAGTTCTTTGGGTAAGGAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)