EMAIL THIS PAGE TO A FRIEND

IRF6

interferon regulatory factor 6

105 Gene Product Result for
Synonyms: LPS OFC6 PIT PPS PPS1 VWS VWS1
UniProtKB ID: O14896, B4DLE2, D3DT90, F5GWX8, G0ZTL0
Gene ID:
Human(3664) Summary: This gene encodes a member of the interferon regulatory transcription factor (IRF) family. Family members share a highly-conserved N-terminal helix-turn-helix DNA-binding domain and a less conserved C-terminal protein-binding domain. The encoded protein may be a transcriptional activator. Mutations in this gene can cause van der Woude syndrome and popliteal pterygium syndrome. Mutations in this gene are also associated with non-syndromic orofacial cleft type 6. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2011]
Mouse(54139) interferon regulatory factor 6
Rat(364081) interferon regulatory factor 6
Zebrafish(393570) interferon regulatory factor 6
dog(480015) interferon regulatory factor 6
cow(614253) interferon regulatory factor 6
Horse(100051502) interferon regulatory factor 6
domestic cat(101087375) interferon regulatory factor 6
chicken(419863) interferon regulatory factor 6
domestic guinea pig(100729739) interferon regulatory factor 6
naked mole-rat(101711748) interferon regulatory factor 6
sheep(443083) interferon regulatory factor 6
Domestic Rabbit(100349520) interferon regulatory factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100039 Anti-IRF6 (441-455) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100038 Anti-IRF6 (61-75) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2101177 Anti-IRF6 (ab1) antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, pig, human, sheep, zebrafish, mouse, horse, bovine, rat
western blot pricing
SAB2101178 Anti-IRF6 (ab2) antibody produced in rabbit affinity isolated antibody bovine, rat, rabbit, mouse, sheep, horse, canine, guinea pig, zebrafish, pig, human
immunohistochemistry, western blot pricing
SAB2101179 Anti-IRF6 (ab3) antibody produced in rabbit affinity isolated antibody pig, mouse, horse, rat, guinea pig, rabbit, canine, sheep, bovine, zebrafish, human
western blot pricing
SAB2500545 Anti-IRF6 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1406044 Anti-IRF6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2702469 Anti-Irf6 antibody produced in rabbit affinity isolated antibody zebrafish
immunohistochemistry pricing
AV43608 Anti-IRF6 antibody produced in rabbit IgG fraction of antiserum rabbit, zebrafish, pig, human, horse, canine, rat, sheep, mouse, bovine, guinea pig
western blot pricing
SAB2102995 Anti-IRF6 antibody produced in rabbit affinity isolated antibody rabbit, sheep, horse, pig, human, canine, bovine, mouse, guinea pig, rat
immunohistochemistry, western blot pricing
HPA063121 Anti-IRF6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA076162 Anti-IRF6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006147 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054271 MISSION® esiRNA esiRNA human IRF6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006147 Rosetta Predictions human pricing
NM_001108859 Rosetta Predictions rat pricing
NM_016851 Rosetta Predictions mouse pricing
NM_178083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150612 predicted 1316
2 SASI_Hs01_00150613 predicted 869
3 SASI_Hs01_00150614 predicted 514
4 SASI_Hs01_00150615 predicted 355
5 SASI_Hs01_00150616 predicted 1184
6 SASI_Hs01_00150617 predicted 791
7 SASI_Hs01_00150618 predicted 1424
8 SASI_Hs01_00150619 predicted 1459
9 SASI_Hs01_00150620 predicted 1098
10 SASI_Hs01_00150621 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242785 predicted 815
2 SASI_Rn02_00242786 predicted 551
3 SASI_Rn02_00242787 predicted 415
4 SASI_Rn02_00242788 predicted 709
5 SASI_Rn02_00242789 predicted 977
6 SASI_Rn02_00242790 predicted 1075
7 SASI_Rn02_00242791 predicted 506
8 SASI_Rn02_00242792 predicted 467
9 SASI_Rn02_00242793 predicted 1348
10 SASI_Rn02_00242794 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137274 predicted 903
2 SASI_Mm01_00137275 predicted 1019
3 SASI_Mm01_00137276 predicted 631
4 SASI_Mm01_00137277 predicted 501
5 SASI_Mm01_00137278 predicted 1869
6 SASI_Mm01_00137279 predicted 552
7 SASI_Mm01_00137280 predicted 1390
8 SASI_Mm01_00137281 predicted 2027
9 SASI_Mm01_00137282 predicted 1273
10 SASI_Mm01_00137283 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174399 predicted 1058
2 SASI_Mm01_00174400 predicted 1259
3 SASI_Mm01_00174401 predicted 1325
4 SASI_Mm01_00174402 predicted 1063
5 SASI_Mm01_00174403 predicted 1249
6 SASI_Mm01_00174404 predicted 1040
7 SASI_Mm01_00174405 predicted 819
8 SASI_Mm01_00174406 predicted 464
9 SASI_Mm01_00174407 predicted 511
10 SASI_Mm01_00174408 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016851
VALIDATED
IRF6 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 6
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-2481s1c1
Sequence:CCGGCCGTTCTTGTTCAGAGACTTTCTCGAGAAAGTCTCTGAACAAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-1339s1c1
Sequence:CCGGCGCATGATCTATGAGATGTTTCTCGAGAAACATCTCATAGATCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-855s1c1
Sequence:CCGGGCAAACTATGACGGTGAGCAACTCGAGTTGCTCACCGTCATAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016851.1-838s1c1
Sequence:CCGGCGTGGGAAGGAGTATGGGCAACTCGAGTTGCCCATACTCCTTCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016851.1-538s1c1
Sequence:CCGGCCTTGGGATGAGAAAGATAATCTCGAGATTATCTTTCTCATCCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016851.2-1815s21c1
Sequence:CCGGGAGATTTGATGTCGAAGTTTACTCGAGTAAACTTCGACATCAAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-546s21c1
Sequence:CCGGACCCAGGGCTCTGTCATTAATCTCGAGATTAATGACAGAGCCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-589s21c1
Sequence:CCGGCTTGGGATGAGAAAGATAATGCTCGAGCATTATCTTTCTCATCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-1107s21c1
Sequence:CCGGGTCAGCGGACATGCCATTTATCTCGAGATAAATGGCATGTCCGCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016851.2-406s21c1
Sequence:CCGGACGATCCTGACCCAGCTAAATCTCGAGATTTAGCTGGGTCAGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-860s21c1
Sequence:CCGGGACTGACTTGGACATCAAATTCTCGAGAATTTGATGTCCAAGTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-505s21c1
Sequence:CCGGTGAATCCTGTGAAGATCTATCCTCGAGGATAGATCTTCACAGGATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-1872s21c1
Sequence:CCGGGACGTTAGACAGATCGTTTAACTCGAGTTAAACGATCTGTCTAACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016851
VALIDATED
IRF6 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 6
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-2481s1c1
Sequence:CCGGCCGTTCTTGTTCAGAGACTTTCTCGAGAAAGTCTCTGAACAAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-1339s1c1
Sequence:CCGGCGCATGATCTATGAGATGTTTCTCGAGAAACATCTCATAGATCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-855s1c1
Sequence:CCGGGCAAACTATGACGGTGAGCAACTCGAGTTGCTCACCGTCATAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016851.1-838s1c1
Sequence:CCGGCGTGGGAAGGAGTATGGGCAACTCGAGTTGCCCATACTCCTTCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016851.1-538s1c1
Sequence:CCGGCCTTGGGATGAGAAAGATAATCTCGAGATTATCTTTCTCATCCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016851.2-1815s21c1
Sequence:CCGGGAGATTTGATGTCGAAGTTTACTCGAGTAAACTTCGACATCAAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-546s21c1
Sequence:CCGGACCCAGGGCTCTGTCATTAATCTCGAGATTAATGACAGAGCCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-589s21c1
Sequence:CCGGCTTGGGATGAGAAAGATAATGCTCGAGCATTATCTTTCTCATCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-1107s21c1
Sequence:CCGGGTCAGCGGACATGCCATTTATCTCGAGATAAATGGCATGTCCGCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016851.2-406s21c1
Sequence:CCGGACGATCCTGACCCAGCTAAATCTCGAGATTTAGCTGGGTCAGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-860s21c1
Sequence:CCGGGACTGACTTGGACATCAAATTCTCGAGAATTTGATGTCCAAGTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-505s21c1
Sequence:CCGGTGAATCCTGTGAAGATCTATCCTCGAGGATAGATCTTCACAGGATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-1872s21c1
Sequence:CCGGGACGTTAGACAGATCGTTTAACTCGAGTTAAACGATCTGTCTAACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016851
VALIDATED
IRF6 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 6
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-2481s1c1
Sequence:CCGGCCGTTCTTGTTCAGAGACTTTCTCGAGAAAGTCTCTGAACAAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-1339s1c1
Sequence:CCGGCGCATGATCTATGAGATGTTTCTCGAGAAACATCTCATAGATCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016851.1-855s1c1
Sequence:CCGGGCAAACTATGACGGTGAGCAACTCGAGTTGCTCACCGTCATAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016851.1-838s1c1
Sequence:CCGGCGTGGGAAGGAGTATGGGCAACTCGAGTTGCCCATACTCCTTCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016851.1-538s1c1
Sequence:CCGGCCTTGGGATGAGAAAGATAATCTCGAGATTATCTTTCTCATCCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360595    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016851.2-1815s21c1
Sequence:CCGGGAGATTTGATGTCGAAGTTTACTCGAGTAAACTTCGACATCAAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-546s21c1
Sequence:CCGGACCCAGGGCTCTGTCATTAATCTCGAGATTAATGACAGAGCCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-589s21c1
Sequence:CCGGCTTGGGATGAGAAAGATAATGCTCGAGCATTATCTTTCTCATCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-1107s21c1
Sequence:CCGGGTCAGCGGACATGCCATTTATCTCGAGATAAATGGCATGTCCGCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016851.2-406s21c1
Sequence:CCGGACGATCCTGACCCAGCTAAATCTCGAGATTTAGCTGGGTCAGGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-860s21c1
Sequence:CCGGGACTGACTTGGACATCAAATTCTCGAGAATTTGATGTCCAAGTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-505s21c1
Sequence:CCGGTGAATCCTGTGAAGATCTATCCTCGAGGATAGATCTTCACAGGATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321594    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016851.2-1872s21c1
Sequence:CCGGGACGTTAGACAGATCGTTTAACTCGAGTTAAACGATCTGTCTAACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006147
IRF6 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006147.2-1676s1c1
Sequence:CCGGGCCATCTTCTTCCTTCTCTTTCTCGAGAAAGAGAAGGAAGAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-1461s1c1
Sequence:CCGGCGGATGATCTACGAGATGTTTCTCGAGAAACATCTCGTAGATCATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-660s1c1
Sequence:CCGGCCCTGGGATGAGAAGGATAATCTCGAGATTATCCTTCTCATCCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-1264s1c1
Sequence:CCGGCCAACCTGATTGAGAGACAAACTCGAGTTTGTCTCTCAATCAGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-876s1c1
Sequence:CCGGGCACCTATACAGCCCTTCTATCTCGAGATAGAAGGGCTGTATAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006147.2-1363s21c1
Sequence:CCGGCACCGTTTGAGATCTACTTATCTCGAGATAAGTAGATCTCAAACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006147.2-1868s21c1
Sequence:CCGGCTCCTAATGGTAGTATGATATCTCGAGATATCATACTACCATTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006147.2-478s21c1
Sequence:CCGGATGACCCTGACCCAGCTAAATCTCGAGATTTAGCTGGGTCAGGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006147
IRF6 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006147.2-1676s1c1
Sequence:CCGGGCCATCTTCTTCCTTCTCTTTCTCGAGAAAGAGAAGGAAGAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-1461s1c1
Sequence:CCGGCGGATGATCTACGAGATGTTTCTCGAGAAACATCTCGTAGATCATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-660s1c1
Sequence:CCGGCCCTGGGATGAGAAGGATAATCTCGAGATTATCCTTCTCATCCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-1264s1c1
Sequence:CCGGCCAACCTGATTGAGAGACAAACTCGAGTTTGTCTCTCAATCAGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-876s1c1
Sequence:CCGGGCACCTATACAGCCCTTCTATCTCGAGATAGAAGGGCTGTATAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006147.2-1363s21c1
Sequence:CCGGCACCGTTTGAGATCTACTTATCTCGAGATAAGTAGATCTCAAACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006147.2-1868s21c1
Sequence:CCGGCTCCTAATGGTAGTATGATATCTCGAGATATCATACTACCATTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006147.2-478s21c1
Sequence:CCGGATGACCCTGACCCAGCTAAATCTCGAGATTTAGCTGGGTCAGGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006147
IRF6 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006147.2-1676s1c1
Sequence:CCGGGCCATCTTCTTCCTTCTCTTTCTCGAGAAAGAGAAGGAAGAAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-1461s1c1
Sequence:CCGGCGGATGATCTACGAGATGTTTCTCGAGAAACATCTCGTAGATCATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-660s1c1
Sequence:CCGGCCCTGGGATGAGAAGGATAATCTCGAGATTATCCTTCTCATCCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-1264s1c1
Sequence:CCGGCCAACCTGATTGAGAGACAAACTCGAGTTTGTCTCTCAATCAGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006147.2-876s1c1
Sequence:CCGGGCACCTATACAGCCCTTCTATCTCGAGATAGAAGGGCTGTATAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006147.2-1363s21c1
Sequence:CCGGCACCGTTTGAGATCTACTTATCTCGAGATAAGTAGATCTCAAACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363493    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006147.2-1868s21c1
Sequence:CCGGCTCCTAATGGTAGTATGATATCTCGAGATATCATACTACCATTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006147.2-478s21c1
Sequence:CCGGATGACCCTGACCCAGCTAAATCTCGAGATTTAGCTGGGTCAGGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)