EMAIL THIS PAGE TO A FRIEND

IRF8

interferon regulatory factor 8

87 Gene Product Result for
Synonyms: H-ICSBP ICSBP ICSBP1 IRF-8
UniProtKB ID: Q02556, A0AV82
Gene ID:
Human(3394) Summary: Interferon consensus sequence-binding protein (ICSBP) is a transcription factor of the interferon (IFN) regulatory factor (IRF) family. Proteins of this family are composed of a conserved DNA-binding domain in the N-terminal region and a divergent C-terminal region that serves as the regulatory domain. The IRF family proteins bind to the IFN-stimulated response element (ISRE) and regulate expression of genes stimulated by type I IFNs, namely IFN-alpha and IFN-beta. IRF family proteins also control expression of IFN-alpha and IFN-beta-regulated genes that are induced by viral infection. [provided by RefSeq, Jul 2008]
Mouse(15900) interferon regulatory factor 8
Rat(292060) interferon regulatory factor 8
Zebrafish(436895) interferon regulatory factor 8
chicken(396385) interferon regulatory factor 8
cow(614909) interferon regulatory factor 8
Horse(100056218) interferon regulatory factor 8
domestic cat(101094225) interferon regulatory factor 8
dog(489673) interferon regulatory factor 8
domestic guinea pig(100725606) interferon regulatory factor 8
naked mole-rat(101705990) interferon regulatory factor 8
sheep(101105432) interferon regulatory factor 8
Domestic Rabbit(100350620) interferon regulatory factor 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500528 Anti-ICSBP1/IRF8 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
HPA002267 Anti-IRF8 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
AV100841 Anti-IRF8 antibody produced in rabbit affinity isolated antibody human, guinea pig, bovine, dog, mouse, rat, horse, rabbit
immunohistochemistry, western blot pricing
HPA002531 Anti-IRF8 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103913 Anti-IRF8 antibody produced in rabbit affinity isolated antibody rabbit, horse, mouse, human, guinea pig, canine, bovine, rat
immunohistochemistry, western blot pricing
SAB2107842 Anti-IRF8 antibody produced in rabbit affinity isolated antibody bovine, horse, mouse, rabbit, rat, human, guinea pig, dog
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023001 MISSION® esiRNA esiRNA targeting mouse Irf8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002163 Rosetta Predictions human pricing
NM_001008722 Rosetta Predictions rat pricing
NM_008320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172816 predicted 982
2 SASI_Hs01_00172817 predicted 354
3 SASI_Hs01_00172818 predicted 1386
4 SASI_Hs01_00172819 predicted 367
5 SASI_Hs01_00172820 predicted 1582
6 SASI_Hs01_00172821 predicted 379
7 SASI_Hs01_00172822 predicted 1387
8 SASI_Hs01_00172823 predicted 1596
9 SASI_Hs01_00172824 predicted 1634
10 SASI_Hs01_00172825 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047867 predicted 394
2 SASI_Rn01_00047868 predicted 573
3 SASI_Rn01_00047869 predicted 1016
4 SASI_Rn01_00047870 predicted 300
5 SASI_Rn01_00047871 predicted 403
6 SASI_Rn01_00047872 predicted 297
7 SASI_Rn01_00047873 predicted 850
8 SASI_Rn01_00047874 predicted 659
9 SASI_Rn01_00047875 predicted 451
10 SASI_Rn01_00047876 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069148 predicted 1103
2 SASI_Mm02_00313641 predicted 1332
3 SASI_Mm01_00069149 predicted 1234
4 SASI_Mm01_00069150 predicted 614
5 SASI_Mm01_00069151 predicted 1090
6 SASI_Mm01_00069152 predicted 594
7 SASI_Mm01_00069153 predicted 879
8 SASI_Mm01_00069154 predicted 842
9 SASI_Mm01_00069155 predicted 349
10 SASI_Mm01_00069157 predicted 458
11 SASI_Mm01_00069156 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002163
VALIDATED
IRF8 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002163.2-1679s21c1
Sequence:CCGGCAGATAGCTGCTTCGATAAAGCTCGAGCTTTATCGAAGCAGCTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002163.2-182s21c1
Sequence:CCGGACGCTGGCAAGCAAGATTATACTCGAGTATAATCTTGCTTGCCAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002163.1-1388s1c1
Sequence:CCGGGCCCGCATCATGATTAAAGAACTCGAGTTCTTTAATCATGATGCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-1278s1c1
Sequence:CCGGGCCTCACACCAGAGATCATTTCTCGAGAAATGATCTCTGGTGTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-300s1c1
Sequence:CCGGGCTTTGAATAAGAGCCCAGATCTCGAGATCTGGGCTCTTATTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-109s1c1
Sequence:CCGGGCATGTATCCAGGACTGATTTCTCGAGAAATCAGTCCTGGATACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002163.1-363s1c1
Sequence:CCGGCCATACAAAGTTTACCGAATTCTCGAGAATTCGGTAAACTTTGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002163
VALIDATED
IRF8 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002163.2-1679s21c1
Sequence:CCGGCAGATAGCTGCTTCGATAAAGCTCGAGCTTTATCGAAGCAGCTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002163.2-182s21c1
Sequence:CCGGACGCTGGCAAGCAAGATTATACTCGAGTATAATCTTGCTTGCCAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002163.1-1388s1c1
Sequence:CCGGGCCCGCATCATGATTAAAGAACTCGAGTTCTTTAATCATGATGCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-1278s1c1
Sequence:CCGGGCCTCACACCAGAGATCATTTCTCGAGAAATGATCTCTGGTGTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-300s1c1
Sequence:CCGGGCTTTGAATAAGAGCCCAGATCTCGAGATCTGGGCTCTTATTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-109s1c1
Sequence:CCGGGCATGTATCCAGGACTGATTTCTCGAGAAATCAGTCCTGGATACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002163.1-363s1c1
Sequence:CCGGCCATACAAAGTTTACCGAATTCTCGAGAATTCGGTAAACTTTGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002163
VALIDATED
IRF8 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002163.2-1679s21c1
Sequence:CCGGCAGATAGCTGCTTCGATAAAGCTCGAGCTTTATCGAAGCAGCTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002163.2-182s21c1
Sequence:CCGGACGCTGGCAAGCAAGATTATACTCGAGTATAATCTTGCTTGCCAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002163.1-1388s1c1
Sequence:CCGGGCCCGCATCATGATTAAAGAACTCGAGTTCTTTAATCATGATGCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-1278s1c1
Sequence:CCGGGCCTCACACCAGAGATCATTTCTCGAGAAATGATCTCTGGTGTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-300s1c1
Sequence:CCGGGCTTTGAATAAGAGCCCAGATCTCGAGATCTGGGCTCTTATTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002163.1-109s1c1
Sequence:CCGGGCATGTATCCAGGACTGATTTCTCGAGAAATCAGTCCTGGATACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002163.1-363s1c1
Sequence:CCGGCCATACAAAGTTTACCGAATTCTCGAGAATTCGGTAAACTTTGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008320
VALIDATED
IRF8 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1291s21c1
Sequence:CCGGATCAACAGATCACCGTCTAAGCTCGAGCTTAGACGGTGATCTGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1011s21c1
Sequence:CCGGATCCGAGAGCTGCAGCAATTCCTCGAGGAATTGCTGCAGCTCTCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-338s21c1
Sequence:CCGGGGACATTTCTGAGCCATATAACTCGAGTTATATGGCTCAGAAATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008320.2-2209s1c1
Sequence:CCGGCCGCTGAAATGGAGTTAGTTTCTCGAGAAACTAACTCCATTTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-629s1c1
Sequence:CCGGCCATTCAGCTTTCTCCCAGATCTCGAGATCTGGGAGAAAGCTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-290s1c1
Sequence:CCGGTCTGAACAAGAGCCCAGATTTCTCGAGAAATCTGGGCTCTTGTTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-170s1c1
Sequence:CCGGGCAGGATTACAATCAGGAGGTCTCGAGACCTCCTGATTGTAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008320.2-350s1c1
Sequence:CCGGGCCATATAAAGTTTACCGAATCTCGAGATTCGGTAAACTTTATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1491s21c1
Sequence:CCGGTGGCCGCAACCTGTGATTAAACTCGAGTTTAATCACAGGTTGCGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1236s21c1
Sequence:CCGGTTCCGCATGTTTCCGGATATCCTCGAGGATATCCGGAAACATGCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008320
VALIDATED
IRF8 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1291s21c1
Sequence:CCGGATCAACAGATCACCGTCTAAGCTCGAGCTTAGACGGTGATCTGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1011s21c1
Sequence:CCGGATCCGAGAGCTGCAGCAATTCCTCGAGGAATTGCTGCAGCTCTCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-338s21c1
Sequence:CCGGGGACATTTCTGAGCCATATAACTCGAGTTATATGGCTCAGAAATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008320.2-2209s1c1
Sequence:CCGGCCGCTGAAATGGAGTTAGTTTCTCGAGAAACTAACTCCATTTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-629s1c1
Sequence:CCGGCCATTCAGCTTTCTCCCAGATCTCGAGATCTGGGAGAAAGCTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-290s1c1
Sequence:CCGGTCTGAACAAGAGCCCAGATTTCTCGAGAAATCTGGGCTCTTGTTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-170s1c1
Sequence:CCGGGCAGGATTACAATCAGGAGGTCTCGAGACCTCCTGATTGTAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008320.2-350s1c1
Sequence:CCGGGCCATATAAAGTTTACCGAATCTCGAGATTCGGTAAACTTTATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1491s21c1
Sequence:CCGGTGGCCGCAACCTGTGATTAAACTCGAGTTTAATCACAGGTTGCGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1236s21c1
Sequence:CCGGTTCCGCATGTTTCCGGATATCCTCGAGGATATCCGGAAACATGCGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008320
VALIDATED
IRF8 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1291s21c1
Sequence:CCGGATCAACAGATCACCGTCTAAGCTCGAGCTTAGACGGTGATCTGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1011s21c1
Sequence:CCGGATCCGAGAGCTGCAGCAATTCCTCGAGGAATTGCTGCAGCTCTCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-338s21c1
Sequence:CCGGGGACATTTCTGAGCCATATAACTCGAGTTATATGGCTCAGAAATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086173    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008320.2-2209s1c1
Sequence:CCGGCCGCTGAAATGGAGTTAGTTTCTCGAGAAACTAACTCCATTTCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-629s1c1
Sequence:CCGGCCATTCAGCTTTCTCCCAGATCTCGAGATCTGGGAGAAAGCTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-290s1c1
Sequence:CCGGTCTGAACAAGAGCCCAGATTTCTCGAGAAATCTGGGCTCTTGTTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008320.2-170s1c1
Sequence:CCGGGCAGGATTACAATCAGGAGGTCTCGAGACCTCCTGATTGTAATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008320.2-350s1c1
Sequence:CCGGGCCATATAAAGTTTACCGAATCTCGAGATTCGGTAAACTTTATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1491s21c1
Sequence:CCGGTGGCCGCAACCTGTGATTAAACTCGAGTTTAATCACAGGTTGCGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008320.3-1236s21c1
Sequence:CCGGTTCCGCATGTTTCCGGATATCCTCGAGGATATCCGGAAACATGCGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)