EMAIL THIS PAGE TO A FRIEND

IRF9

interferon regulatory factor 9

105 Gene Product Result for
Synonyms: IRF-9 ISGF3 ISGF3G p48
UniProtKB ID: Q00978, D3DS61
Gene ID:
Mouse(16391) interferon regulatory factor 9
Rat(305896) interferon regulatory factor 9
sheep(101116656) interferon regulatory factor 9
domestic guinea pig(100714136) interferon regulatory factor 9
naked mole-rat(101701338) interferon regulatory factor 9
Zebrafish(403013) interferon regulatory factor 9
cow(509855) interferon regulatory factor 9
domestic cat(101100970) interferon regulatory factor 9
dog(607899) interferon regulatory factor 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006084 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006084 Rosetta Predictions human pricing
NM_001012041 Rosetta Predictions rat pricing
XM_573775 Rosetta Predictions rat pricing
NM_008394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025478 predicted 1206
2 SASI_Hs01_00025479 predicted 1109
3 SASI_Hs01_00025480 predicted 1193
4 SASI_Hs01_00025481 predicted 378
5 SASI_Hs01_00025482 predicted 383
6 SASI_Hs01_00025483 predicted 1111
7 SASI_Hs02_00340861 predicted 1070
8 SASI_Hs01_00025484 predicted 955
9 SASI_Hs01_00025485 predicted 254
10 SASI_Hs01_00025486 predicted 387
11 SASI_Hs01_00025477 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101554 predicted 339
2 SASI_Rn01_00101555 predicted 276
3 SASI_Rn01_00101557 predicted 1267
4 SASI_Rn01_00101558 predicted 402
5 SASI_Rn01_00101559 predicted 940
6 SASI_Rn01_00101560 predicted 351
7 SASI_Rn01_00101561 predicted 1227
8 SASI_Rn01_00101562 predicted 578
9 SASI_Rn02_00200140 predicted 1073
10 SASI_Rn01_00101563 predicted 840
11 SASI_Rn01_00101556 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146794 predicted 376
2 SASI_Rn01_00146795 predicted 308
3 SASI_Rn01_00146796 predicted 511
4 SASI_Rn01_00146797 predicted 594
5 SASI_Rn01_00146798 predicted 730
6 SASI_Rn01_00146799 predicted 440
7 SASI_Rn01_00146800 predicted 620
8 SASI_Rn01_00146801 predicted 390
9 SASI_Rn01_00146802 predicted 615
10 SASI_Rn01_00146803 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313807 predicted 470
2 SASI_Mm02_00313808 predicted 604
3 SASI_Mm02_00313809 predicted 1105
4 SASI_Mm02_00313810 predicted 550
5 SASI_Mm02_00313811 predicted 1175
6 SASI_Mm02_00313812 predicted 465
7 SASI_Mm02_00313813 predicted 1351
8 SASI_Mm02_00313814 predicted 1131
9 SASI_Mm02_00313815 predicted 682
10 SASI_Mm02_00313816 predicted 1083
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008394
VALIDATED
IRF9 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-417s21c1
Sequence:CCGGCTCAACAAGAGTTCCGAATTTCTCGAGAAATTCGGAACTCTTGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-1169s21c1
Sequence:CCGGGTTCCAAGCAACCCTACATTTCTCGAGAAATGTAGGGTTGCTTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008394.2-1467s21c1
Sequence:CCGGGTGATGTTTCTCCTTACAAATCTCGAGATTTGTAAGGAGAAACATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008394.2-477s21c1
Sequence:CCGGCCCTACAAAGTATATCGAATACTCGAGTATTCGATATACTTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-602s21c1
Sequence:CCGGGAGGACCAATGGCGTTGTAAACTCGAGTTTACAACGCCATTGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008394.2-1500s1c1
Sequence:CCGGGCAGACTTGTTGAGGATACTTCTCGAGAAGTATCCTCAACAAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1209s1c1
Sequence:CCGGTCTAGCCATAGCCAAGAGAATCTCGAGATTCTCTTGGCTATGGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1261s1c1
Sequence:CCGGCCCGACATTTACTGGAGAAGACTCGAGTCTTCTCCAGTAAATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1100s1c1
Sequence:CCGGGCTCTTCAAGACCACCTACTTCTCGAGAAGTAGGTGGTCTTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-477s1c1
Sequence:CCGGCCCTACAAAGTATATCGAATACTCGAGTATTCGATATACTTTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008394
VALIDATED
IRF9 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-417s21c1
Sequence:CCGGCTCAACAAGAGTTCCGAATTTCTCGAGAAATTCGGAACTCTTGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-1169s21c1
Sequence:CCGGGTTCCAAGCAACCCTACATTTCTCGAGAAATGTAGGGTTGCTTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008394.2-1467s21c1
Sequence:CCGGGTGATGTTTCTCCTTACAAATCTCGAGATTTGTAAGGAGAAACATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008394.2-477s21c1
Sequence:CCGGCCCTACAAAGTATATCGAATACTCGAGTATTCGATATACTTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-602s21c1
Sequence:CCGGGAGGACCAATGGCGTTGTAAACTCGAGTTTACAACGCCATTGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008394.2-1500s1c1
Sequence:CCGGGCAGACTTGTTGAGGATACTTCTCGAGAAGTATCCTCAACAAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1209s1c1
Sequence:CCGGTCTAGCCATAGCCAAGAGAATCTCGAGATTCTCTTGGCTATGGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1261s1c1
Sequence:CCGGCCCGACATTTACTGGAGAAGACTCGAGTCTTCTCCAGTAAATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1100s1c1
Sequence:CCGGGCTCTTCAAGACCACCTACTTCTCGAGAAGTAGGTGGTCTTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-477s1c1
Sequence:CCGGCCCTACAAAGTATATCGAATACTCGAGTATTCGATATACTTTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008394
VALIDATED
IRF9 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-417s21c1
Sequence:CCGGCTCAACAAGAGTTCCGAATTTCTCGAGAAATTCGGAACTCTTGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-1169s21c1
Sequence:CCGGGTTCCAAGCAACCCTACATTTCTCGAGAAATGTAGGGTTGCTTGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008394.2-1467s21c1
Sequence:CCGGGTGATGTTTCTCCTTACAAATCTCGAGATTTGTAAGGAGAAACATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008394.2-477s21c1
Sequence:CCGGCCCTACAAAGTATATCGAATACTCGAGTATTCGATATACTTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008394.2-602s21c1
Sequence:CCGGGAGGACCAATGGCGTTGTAAACTCGAGTTTACAACGCCATTGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008394.2-1500s1c1
Sequence:CCGGGCAGACTTGTTGAGGATACTTCTCGAGAAGTATCCTCAACAAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1209s1c1
Sequence:CCGGTCTAGCCATAGCCAAGAGAATCTCGAGATTCTCTTGGCTATGGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1261s1c1
Sequence:CCGGCCCGACATTTACTGGAGAAGACTCGAGTCTTCTCCAGTAAATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-1100s1c1
Sequence:CCGGGCTCTTCAAGACCACCTACTTCTCGAGAAGTAGGTGGTCTTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008394.2-477s1c1
Sequence:CCGGCCCTACAAAGTATATCGAATACTCGAGTATTCGATATACTTTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006084
VALIDATED
IRF9 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1116s21c1
Sequence:CCGGGAGACTTGGTCAGGTACTTTCCTCGAGGAAAGTACCTGACCAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006084.4-503s21c1
Sequence:GTACCGGACTCAGAAAGTACCATCAAAGCTCGAGCTTTGATGGTACTTTCTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1204s21c1
Sequence:GTACCGGCCATACTCCACAGAATCTTATCTCGAGATAAGATTCTGTGGAGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1411s21c1
Sequence:CCGGCTCAGTAGTTGTCCGTGATAACTCGAGTTATCACGGACAACTACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-302s21c1
Sequence:CCGGTTCAAGGCCTGGGCAATATTTCTCGAGAAATATTGCCCAGGCCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-1110s1c1
Sequence:CCGGGCCATACTCCACAGAATCTTACTCGAGTAAGATTCTGTGGAGTATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-694s1c1
Sequence:CCGGGCTGCTCACCTTCATCTACAACTCGAGTTGTAGATGAAGGTGAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-293s1c1
Sequence:CCGGGCACTCAACAAGAGTTCTGAACTCGAGTTCAGAACTCTTGTTGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006084.3-134s1c1
Sequence:CCGGGCTAAGACCATGTTCCGGATTCTCGAGAATCCGGAACATGGTCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-355s1c1
Sequence:CCGGGCCCTACAAGGTGTATCAGTTCTCGAGAACTGATACACCTTGTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006084
VALIDATED
IRF9 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1116s21c1
Sequence:CCGGGAGACTTGGTCAGGTACTTTCCTCGAGGAAAGTACCTGACCAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006084.4-503s21c1
Sequence:GTACCGGACTCAGAAAGTACCATCAAAGCTCGAGCTTTGATGGTACTTTCTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1204s21c1
Sequence:GTACCGGCCATACTCCACAGAATCTTATCTCGAGATAAGATTCTGTGGAGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1411s21c1
Sequence:CCGGCTCAGTAGTTGTCCGTGATAACTCGAGTTATCACGGACAACTACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-302s21c1
Sequence:CCGGTTCAAGGCCTGGGCAATATTTCTCGAGAAATATTGCCCAGGCCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-1110s1c1
Sequence:CCGGGCCATACTCCACAGAATCTTACTCGAGTAAGATTCTGTGGAGTATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-694s1c1
Sequence:CCGGGCTGCTCACCTTCATCTACAACTCGAGTTGTAGATGAAGGTGAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-293s1c1
Sequence:CCGGGCACTCAACAAGAGTTCTGAACTCGAGTTCAGAACTCTTGTTGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006084.3-134s1c1
Sequence:CCGGGCTAAGACCATGTTCCGGATTCTCGAGAATCCGGAACATGGTCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-355s1c1
Sequence:CCGGGCCCTACAAGGTGTATCAGTTCTCGAGAACTGATACACCTTGTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006084
VALIDATED
IRF9 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1116s21c1
Sequence:CCGGGAGACTTGGTCAGGTACTTTCCTCGAGGAAAGTACCTGACCAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006084.4-503s21c1
Sequence:GTACCGGACTCAGAAAGTACCATCAAAGCTCGAGCTTTGATGGTACTTTCTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1204s21c1
Sequence:GTACCGGCCATACTCCACAGAATCTTATCTCGAGATAAGATTCTGTGGAGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-1411s21c1
Sequence:CCGGCTCAGTAGTTGTCCGTGATAACTCGAGTTATCACGGACAACTACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006084.4-302s21c1
Sequence:CCGGTTCAAGGCCTGGGCAATATTTCTCGAGAAATATTGCCCAGGCCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-1110s1c1
Sequence:CCGGGCCATACTCCACAGAATCTTACTCGAGTAAGATTCTGTGGAGTATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-694s1c1
Sequence:CCGGGCTGCTCACCTTCATCTACAACTCGAGTTGTAGATGAAGGTGAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-293s1c1
Sequence:CCGGGCACTCAACAAGAGTTCTGAACTCGAGTTCAGAACTCTTGTTGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006084.3-134s1c1
Sequence:CCGGGCTAAGACCATGTTCCGGATTCTCGAGAATCCGGAACATGGTCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006084.3-355s1c1
Sequence:CCGGGCCCTACAAGGTGTATCAGTTCTCGAGAACTGATACACCTTGTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)