EMAIL THIS PAGE TO A FRIEND

IRG1

immunoresponsive 1 homolog (mouse)

68 Gene Product Result for
Synonyms: CAD
UniProtKB ID: A6NK06
Gene ID:
Mouse(16365) immunoresponsive gene 1
Rat(306127) immunoresponsive gene 1
Zebrafish(795305) immunoresponsive gene 1
chicken(418812) immunoresponsive 1 homolog (mouse)
dog(485496) immunoresponsive 1 homolog (mouse)
Horse(100052594) immunoresponsive 1 homolog (mouse)
domestic cat(101088973) immunoresponsive 1 homolog (mouse)
domestic guinea pig(100727062) immunoresponsive 1 homolog (mouse)
naked mole-rat(101714481) immunoresponsive 1 homolog (mouse)
sheep(101102743) immunoresponsive 1 homolog (mouse)
Domestic Rabbit(100343808) immunoresponsive 1 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001127275 Rosetta Predictions human pricing
XM_001133269 Rosetta Predictions human pricing
XM_001722295 Rosetta Predictions human pricing
NM_001107282 Rosetta Predictions rat pricing
NM_008392 Rosetta Predictions mouse pricing
XM_127883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001127275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383699 predicted 603
2 SASI_Hs02_00383700 predicted 825
3 SASI_Hs02_00383701 predicted 1090
4 SASI_Hs02_00383702 predicted 1763
5 SASI_Hs02_00383703 predicted 1904
6 SASI_Hs02_00383704 predicted 1431
7 SASI_Hs02_00383705 predicted 1584
8 SASI_Hs02_00383706 predicted 730
9 SASI_Hs02_00383707 predicted 1908
10 SASI_Hs02_00383708 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390551 predicted 1544
2 SASI_Hs02_00390552 predicted 1764
3 SASI_Hs02_00390553 predicted 1907
4 SASI_Hs02_00390554 predicted 1434
5 SASI_Hs02_00390555 predicted 1583
6 SASI_Hs02_00390556 predicted 1908
7 SASI_Hs02_00390557 predicted 1864
8 SASI_Hs02_00390558 predicted 1684
9 SASI_Hs02_00390559 predicted 1866
10 SASI_Hs02_00390560 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00448234 predicted 601
2 SASI_Hs02_00448235 predicted 825
3 SASI_Hs02_00448236 predicted 1086
4 SASI_Hs02_00448237 predicted 1759
5 SASI_Hs02_00448238 predicted 1907
6 SASI_Hs02_00448239 predicted 1430
7 SASI_Hs02_00448240 predicted 1587
8 SASI_Hs02_00448241 predicted 737
9 SASI_Hs02_00448242 predicted 1908
10 SASI_Hs02_00448243 predicted 1687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227305 predicted 1167
2 SASI_Rn02_00227306 predicted 1407
3 SASI_Rn02_00227307 predicted 1641
4 SASI_Rn02_00227308 predicted 1537
5 SASI_Rn02_00227309 predicted 1505
6 SASI_Rn02_00227310 predicted 1599
7 SASI_Rn02_00227311 predicted 357
8 SASI_Rn02_00227312 predicted 1463
9 SASI_Rn02_00227313 predicted 1649
10 SASI_Rn02_00227314 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313797 predicted 1038
2 SASI_Mm02_00313798 predicted 974
3 SASI_Mm02_00313799 predicted 1369
4 SASI_Mm02_00313800 predicted 1127
5 SASI_Mm02_00313801 predicted 1425
6 SASI_Mm02_00313802 predicted 1209
7 SASI_Mm02_00313803 predicted 1407
8 SASI_Mm02_00313804 predicted 453
9 SASI_Mm02_00313805 predicted 199
10 SASI_Mm02_00313806 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219012 predicted 1119
2 SASI_Mm01_00219013 predicted 1445
3 SASI_Mm01_00219014 predicted 1201
4 SASI_Mm01_00219015 predicted 1506
5 SASI_Mm01_00219016 predicted 1293
6 SASI_Mm01_00219017 predicted 1488
7 SASI_Mm01_00219018 predicted 1708
8 SASI_Mm01_00219019 predicted 525
9 SASI_Mm01_00219020 predicted 288
10 SASI_Mm01_00219021 predicted 1747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008392
IRG1 MISSION shRNA Bacterial Glycerol Stock
immunoresponsive 1 homolog (mouse)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008392.1-2368s21c1
Sequence:CCGGTGTTTGGAAATCACCATATAACTCGAGTTATATGGTGATTTCCAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-999s21c1
Sequence:CCGGCCTGACGTCCAGTACGTAAACCTCGAGGTTTACGTACTGGACGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-206s21c1
Sequence:CCGGCCATAAAGTCACCCAATATAGCTCGAGCTATATTGGGTGACTTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-276s21c1
Sequence:CCGGTTCAGGCTCCCACCGACATATCTCGAGATATGTCGGTGGGAGCCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-470s21c1
Sequence:CCGGTGAAGTACAGGGACGATTAATCTCGAGATTAATCGTCCCTGTACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008392
IRG1 MISSION shRNA shRNA Plasmid DNA
immunoresponsive 1 homolog (mouse)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008392.1-2368s21c1
Sequence:CCGGTGTTTGGAAATCACCATATAACTCGAGTTATATGGTGATTTCCAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-999s21c1
Sequence:CCGGCCTGACGTCCAGTACGTAAACCTCGAGGTTTACGTACTGGACGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-206s21c1
Sequence:CCGGCCATAAAGTCACCCAATATAGCTCGAGCTATATTGGGTGACTTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-276s21c1
Sequence:CCGGTTCAGGCTCCCACCGACATATCTCGAGATATGTCGGTGGGAGCCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-470s21c1
Sequence:CCGGTGAAGTACAGGGACGATTAATCTCGAGATTAATCGTCCCTGTACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008392
IRG1 MISSION shRNA Lentiviral Transduction Particles
immunoresponsive 1 homolog (mouse)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008392.1-2368s21c1
Sequence:CCGGTGTTTGGAAATCACCATATAACTCGAGTTATATGGTGATTTCCAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-999s21c1
Sequence:CCGGCCTGACGTCCAGTACGTAAACCTCGAGGTTTACGTACTGGACGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-206s21c1
Sequence:CCGGCCATAAAGTCACCCAATATAGCTCGAGCTATATTGGGTGACTTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-276s21c1
Sequence:CCGGTTCAGGCTCCCACCGACATATCTCGAGATATGTCGGTGGGAGCCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008392.1-470s21c1
Sequence:CCGGTGAAGTACAGGGACGATTAATCTCGAGATTAATCGTCCCTGTACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)