EMAIL THIS PAGE TO A FRIEND

IRGM

immunity-related GTPase family, M

63 Gene Product Result for
Synonyms: IFI1 IRGM1 LRG-47 LRG47
UniProtKB ID: A1A4Y4, B3VEX0
Gene ID:
Human(345611) Summary: This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis.[provided by RefSeq, Oct 2010]
Rat(303090) immunity-related GTPase family, M
dog(606863) immunity-related GTPase family, M
dog(481473) immunity-related GTPase family M protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4543 Anti-IRGM (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4545 Anti-IRGM (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900758 Anti-IRGM antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB1307004 ANTI-IRGM(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_293893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293893 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU232231 MISSION® esiRNA esiRNA targeting human IRGM human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040407 Rosetta Predictions human pricing
XR_040408 Rosetta Predictions human pricing
XR_040409 Rosetta Predictions human pricing
NM_001012007 Rosetta Predictions rat pricing
XM_573078 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518571 predicted 217
2 SASI_Hs02_00518572 predicted 213
3 SASI_Hs02_00518573 predicted 318
4 SASI_Hs02_00518574 predicted 304
5 SASI_Hs02_00518575 predicted 211
6 SASI_Hs02_00518576 predicted 311
7 SASI_Hs02_00518577 predicted 299
8 SASI_Hs02_00518578 predicted 207
9 SASI_Hs02_00518579 predicted 303
10 SASI_Hs02_00518580 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518581 predicted 219
2 SASI_Hs02_00518582 predicted 216
3 SASI_Hs02_00518583 predicted 324
4 SASI_Hs02_00518584 predicted 295
5 SASI_Hs02_00518585 predicted 205
6 SASI_Hs02_00518586 predicted 309
7 SASI_Hs02_00518587 predicted 298
8 SASI_Hs02_00518588 predicted 206
9 SASI_Hs02_00518589 predicted 299
10 SASI_Hs02_00518590 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518591 predicted 211
2 SASI_Hs02_00518592 predicted 208
3 SASI_Hs02_00518593 predicted 312
4 SASI_Hs02_00518594 predicted 295
5 SASI_Hs02_00518595 predicted 201
6 SASI_Hs02_00518596 predicted 306
7 SASI_Hs02_00518597 predicted 290
8 SASI_Hs02_00518598 predicted 204
9 SASI_Hs02_00518599 predicted 296
10 SASI_Hs02_00518600 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067721 predicted 549
2 SASI_Rn01_00067722 predicted 1556
3 SASI_Rn01_00067723 predicted 714
4 SASI_Rn02_00200083 predicted 844
5 SASI_Rn01_00067724 predicted 616
6 SASI_Rn02_00200084 predicted 1166
7 SASI_Rn01_00067726 predicted 1484
8 SASI_Rn01_00067727 predicted 1268
9 SASI_Rn01_00067728 predicted 944
10 SASI_Rn01_00067729 predicted 602
11 SASI_Rn01_00067725 predicted 1177
12 SASI_Rn01_00067730 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137447 predicted 561
2 SASI_Rn01_00137448 predicted 716
3 SASI_Rn01_00137449 predicted 622
4 SASI_Rn01_00137450 predicted 1088
5 SASI_Rn01_00137451 predicted 777
6 SASI_Rn01_00137452 predicted 1175
7 SASI_Rn01_00137453 predicted 546
8 SASI_Rn01_00137454 predicted 691
9 SASI_Rn01_00137455 predicted 944
10 SASI_Rn01_00137456 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293893
IRGM MISSION shRNA Bacterial Glycerol Stock
immunity-related GTPase family, M
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000197363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-324s1c1
Sequence:CCGGCCGGTATGACTTCATCATGGTCTCGAGACCATGATGAAGTCATACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-84s1c1
Sequence:CCGGGACACCAGTTAACATCACTATCTCGAGATAGTGATGTTAACTGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-352s1c1
Sequence:CCGGGCACAATTCAGCATGAATCATCTCGAGATGATTCATGCTGAATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-36s1c1
Sequence:CCGGGCCAGAGGTGATCTCTAACATCTCGAGATGTTAGAGATCACCTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293893
IRGM MISSION shRNA shRNA Plasmid DNA
immunity-related GTPase family, M
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000197363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-324s1c1
Sequence:CCGGCCGGTATGACTTCATCATGGTCTCGAGACCATGATGAAGTCATACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-84s1c1
Sequence:CCGGGACACCAGTTAACATCACTATCTCGAGATAGTGATGTTAACTGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-352s1c1
Sequence:CCGGGCACAATTCAGCATGAATCATCTCGAGATGATTCATGCTGAATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-36s1c1
Sequence:CCGGGCCAGAGGTGATCTCTAACATCTCGAGATGTTAGAGATCACCTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293893
IRGM MISSION shRNA Lentiviral Transduction Particles
immunity-related GTPase family, M
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000197363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-324s1c1
Sequence:CCGGCCGGTATGACTTCATCATGGTCTCGAGACCATGATGAAGTCATACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-84s1c1
Sequence:CCGGGACACCAGTTAACATCACTATCTCGAGATAGTGATGTTAACTGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-352s1c1
Sequence:CCGGGCACAATTCAGCATGAATCATCTCGAGATGATTCATGCTGAATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204829    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_293893.2-36s1c1
Sequence:CCGGGCCAGAGGTGATCTCTAACATCTCGAGATGTTAGAGATCACCTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)