EMAIL THIS PAGE TO A FRIEND

IRGQ

immunity-related GTPase family, Q

79 Gene Product Result for
Synonyms: IRGQ1
UniProtKB ID: Q8WZA9, B2RNP3
Gene ID:
Mouse(210146) immunity-related GTPase family, Q
Rat(292708) immunity-related GTPase family, Q
domestic guinea pig(100727751) immunity-related GTPase family, Q
naked mole-rat(101704119) immunity-related GTPase family, Q
sheep(101107040) immunity-related GTPase family, Q
dog(612411) immunity-related GTPase family, Q
cow(616834) immunity-related GTPase family, Q
domestic cat(101080596) immunity-related GTPase family, Q
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007561 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007561 Rosetta Predictions human pricing
XM_218444 Rosetta Predictions rat pricing
XR_009096 Rosetta Predictions rat pricing
NM_153134 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173686 predicted 1156
2 SASI_Hs01_00173687 predicted 506
3 SASI_Hs01_00173688 predicted 1211
4 SASI_Hs01_00173689 predicted 1138
5 SASI_Hs01_00173690 predicted 897
6 SASI_Hs01_00173691 predicted 1292
7 SASI_Hs01_00173692 predicted 1060
8 SASI_Hs01_00173693 predicted 889
9 SASI_Hs01_00173694 predicted 400
10 SASI_Hs01_00173695 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377731 predicted 747
2 SASI_Rn02_00377732 predicted 271
3 SASI_Rn02_00377733 predicted 632
4 SASI_Rn02_00377734 predicted 464
5 SASI_Rn02_00377735 predicted 430
6 SASI_Rn02_00377736 predicted 453
7 SASI_Rn02_00377737 predicted 625
8 SASI_Rn02_00377738 predicted 751
9 SASI_Rn02_00377739 predicted 491
10 SASI_Rn02_00377740 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009096 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00418748 predicted 2228
2 SASI_Rn02_00418749 predicted 2133
3 SASI_Rn01_00152881 predicted 2070
4 SASI_Rn01_00152882 predicted 2203
5 SASI_Rn01_00152883 predicted 1915
6 SASI_Rn02_00418750 predicted 2112
7 SASI_Rn01_00152885 predicted 2157
8 SASI_Rn02_00418751 predicted 2192
9 SASI_Rn02_00418752 predicted 1893
10 SASI_Rn02_00418753 predicted 2130
11 SASI_Rn01_00152878 predicted 1250
12 SASI_Rn01_00152879 predicted 1299
13 SASI_Rn01_00152880 predicted 2121
14 SASI_Rn01_00152884 predicted 349
15 SASI_Rn01_00152886 predicted 483
16 SASI_Rn01_00152887 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096694 predicted 303
2 SASI_Mm01_00096695 predicted 2105
3 SASI_Mm01_00096696 predicted 583
4 SASI_Mm01_00096697 predicted 2094
5 SASI_Mm02_00343002 predicted 2089
6 SASI_Mm02_00343003 predicted 588
7 SASI_Mm01_00096699 predicted 434
8 SASI_Mm02_00343004 predicted 2104
9 SASI_Mm01_00096700 predicted 619
10 SASI_Mm01_00096703 predicted 1893
11 SASI_Mm01_00096698 predicted 914
12 SASI_Mm01_00096701 predicted 2142
13 SASI_Mm01_00096702 predicted 2065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007561
IRGQ MISSION shRNA Bacterial Glycerol Stock
immunity-related GTPase family, Q
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1233s1c1
Sequence:CCGGCAAGGGCGAGAGCTTAAAGAACTCGAGTTCTTTAAGCTCTCGCCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1286s1c1
Sequence:CCGGGTAAGGGAAGGGAGAAATGTACTCGAGTACATTTCTCCCTTCCCTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1268s1c1
Sequence:CCGGGATTGGAGAATGCACTCAGTACTCGAGTACTGAGTGCATTCTCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007561.2-2077s21c1
Sequence:CCGGGCTTAATCCTGGGTGCTTGAACTCGAGTTCAAGCACCCAGGATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007561.2-1173s21c1
Sequence:CCGGGTGTCTGGGAGAAGGCAAGATCTCGAGATCTTGCCTTCTCCCAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007561.2-575s21c1
Sequence:CCGGTAGGAGCTGCGGATCTGTTTGCTCGAGCAAACAGATCCGCAGCTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1375s1c1
Sequence:CCGGGTTGTCGGCATGAAGAAATCACTCGAGTGATTTCTTCATGCCGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-904s1c1
Sequence:CCGGGACATGCTGCTTGGATTGGATCTCGAGATCCAATCCAAGCAGCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1273s1c1
Sequence:CCGGGAGAATGCACTCAGTAAGGGACTCGAGTCCCTTACTGAGTGCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007561
IRGQ MISSION shRNA shRNA Plasmid DNA
immunity-related GTPase family, Q
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1233s1c1
Sequence:CCGGCAAGGGCGAGAGCTTAAAGAACTCGAGTTCTTTAAGCTCTCGCCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1286s1c1
Sequence:CCGGGTAAGGGAAGGGAGAAATGTACTCGAGTACATTTCTCCCTTCCCTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1268s1c1
Sequence:CCGGGATTGGAGAATGCACTCAGTACTCGAGTACTGAGTGCATTCTCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007561.2-2077s21c1
Sequence:CCGGGCTTAATCCTGGGTGCTTGAACTCGAGTTCAAGCACCCAGGATTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007561.2-1173s21c1
Sequence:CCGGGTGTCTGGGAGAAGGCAAGATCTCGAGATCTTGCCTTCTCCCAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007561.2-575s21c1
Sequence:CCGGTAGGAGCTGCGGATCTGTTTGCTCGAGCAAACAGATCCGCAGCTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1375s1c1
Sequence:CCGGGTTGTCGGCATGAAGAAATCACTCGAGTGATTTCTTCATGCCGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-904s1c1
Sequence:CCGGGACATGCTGCTTGGATTGGATCTCGAGATCCAATCCAAGCAGCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1273s1c1
Sequence:CCGGGAGAATGCACTCAGTAAGGGACTCGAGTCCCTTACTGAGTGCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007561
IRGQ MISSION shRNA Lentiviral Transduction Particles
immunity-related GTPase family, Q
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1233s1c1
Sequence:CCGGCAAGGGCGAGAGCTTAAAGAACTCGAGTTCTTTAAGCTCTCGCCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1286s1c1
Sequence:CCGGGTAAGGGAAGGGAGAAATGTACTCGAGTACATTTCTCCCTTCCCTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1268s1c1
Sequence:CCGGGATTGGAGAATGCACTCAGTACTCGAGTACTGAGTGCATTCTCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007561.2-2077s21c1
Sequence:CCGGGCTTAATCCTGGGTGCTTGAACTCGAGTTCAAGCACCCAGGATTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007561.2-1173s21c1
Sequence:CCGGGTGTCTGGGAGAAGGCAAGATCTCGAGATCTTGCCTTCTCCCAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007561.2-575s21c1
Sequence:CCGGTAGGAGCTGCGGATCTGTTTGCTCGAGCAAACAGATCCGCAGCTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1375s1c1
Sequence:CCGGGTTGTCGGCATGAAGAAATCACTCGAGTGATTTCTTCATGCCGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-904s1c1
Sequence:CCGGGACATGCTGCTTGGATTGGATCTCGAGATCCAATCCAAGCAGCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007561.1-1273s1c1
Sequence:CCGGGAGAATGCACTCAGTAAGGGACTCGAGTCCCTTACTGAGTGCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153134
VALIDATED
IRGQ MISSION shRNA Bacterial Glycerol Stock
immunity-related GTPase family, Q
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-333s21c1
Sequence:CCGGCCGCGTTATGCGGTAAGAATGCTCGAGCATTCTTACCGCATAACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-617s21c1
Sequence:CCGGGATTCCCAGAATGCAGCTAAACTCGAGTTTAGCTGCATTCTGGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-478s21c1
Sequence:CCGGGGAGGCCAACTTGCTGGTATTCTCGAGAATACCAGCAAGTTGGCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153134.2-1292s1c1
Sequence:CCGGCGAAGGAAAGAAAGCTGGCATCTCGAGATGCCAGCTTTCTTTCCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153134.2-1892s1c1
Sequence:CCGGCGGTGTACTTCTACAAGCCTTCTCGAGAAGGCTTGTAGAAGTACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153134.3-3521s21c1
Sequence:CCGGACAGTAGGTGCCTAGTATTTACTCGAGTAAATACTAGGCACCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153134.3-961s21c1
Sequence:CCGGTGTAGGCCTTGTGCTAGATATCTCGAGATATCTAGCACAAGGCCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153134
VALIDATED
IRGQ MISSION shRNA shRNA Plasmid DNA
immunity-related GTPase family, Q
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-333s21c1
Sequence:CCGGCCGCGTTATGCGGTAAGAATGCTCGAGCATTCTTACCGCATAACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-617s21c1
Sequence:CCGGGATTCCCAGAATGCAGCTAAACTCGAGTTTAGCTGCATTCTGGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-478s21c1
Sequence:CCGGGGAGGCCAACTTGCTGGTATTCTCGAGAATACCAGCAAGTTGGCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153134.2-1292s1c1
Sequence:CCGGCGAAGGAAAGAAAGCTGGCATCTCGAGATGCCAGCTTTCTTTCCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153134.2-1892s1c1
Sequence:CCGGCGGTGTACTTCTACAAGCCTTCTCGAGAAGGCTTGTAGAAGTACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153134.3-3521s21c1
Sequence:CCGGACAGTAGGTGCCTAGTATTTACTCGAGTAAATACTAGGCACCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153134.3-961s21c1
Sequence:CCGGTGTAGGCCTTGTGCTAGATATCTCGAGATATCTAGCACAAGGCCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153134
VALIDATED
IRGQ MISSION shRNA Lentiviral Transduction Particles
immunity-related GTPase family, Q
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-333s21c1
Sequence:CCGGCCGCGTTATGCGGTAAGAATGCTCGAGCATTCTTACCGCATAACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-617s21c1
Sequence:CCGGGATTCCCAGAATGCAGCTAAACTCGAGTTTAGCTGCATTCTGGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153134.3-478s21c1
Sequence:CCGGGGAGGCCAACTTGCTGGTATTCTCGAGAATACCAGCAAGTTGGCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153134.2-1292s1c1
Sequence:CCGGCGAAGGAAAGAAAGCTGGCATCTCGAGATGCCAGCTTTCTTTCCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153134.2-1892s1c1
Sequence:CCGGCGGTGTACTTCTACAAGCCTTCTCGAGAAGGCTTGTAGAAGTACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153134.3-3521s21c1
Sequence:CCGGACAGTAGGTGCCTAGTATTTACTCGAGTAAATACTAGGCACCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153134.3-961s21c1
Sequence:CCGGTGTAGGCCTTGTGCTAGATATCTCGAGATATCTAGCACAAGGCCTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)