EMAIL THIS PAGE TO A FRIEND

IRS1

insulin receptor substrate 1

136 Gene Product Result for
Synonyms: HIRS-1
UniProtKB ID: P35568
Gene ID:
Human(3667) Summary: This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
Mouse(16367) insulin receptor substrate 1
Rat(25467) insulin receptor substrate 1
Zebrafish(559281) insulin receptor substrate 1
cow(538598) insulin receptor substrate 1
domestic cat(100271862) insulin receptor substrate 1
domestic cat(101087257) insulin receptor substrate 1
dog(486148) insulin receptor substrate 1
chicken(429262) insulin receptor substrate 1
chicken(101666036) insulin receptor substrate 1
chicken(101749888) insulin receptor substrate 1
chicken(429126) insulin receptor substrate 1
sheep(101102293) insulin receptor substrate 1
Domestic Rabbit(100339981) insulin receptor substrate 1
domestic guinea pig(100716939) insulin receptor substrate 1
naked mole-rat(101708189) insulin receptor substrate 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
I7153 Anti-Insulin Receptor Substrate 1 (IRS-1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunoprecipitation (IP), western blot pricing
SAB3500281 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
SAB4501567 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4501568 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4501569 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4501570 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4501571 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501572 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4501573 Anti-IRS-1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4300482 Anti-IRS1 (Ab-636) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300483 Anti-IRS1 (Ab-639) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, western blot pricing
SAB1406045 Anti-IRS1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA046433 Anti-IRS1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
I2533 Anti-phospho-Insulin Receptor Substrate-1 (pSer312) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
I1658 Anti-phospho-Insulin Receptor Substrate-1 (pTyr1179) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
I2283 Anti-phospho-Insulin Receptor Substrate-1 (pTyr1229) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
I2658 Anti-phospho-Insulin Receptor Substrate-1 (pTyr612) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
I2408 Anti-phospho-Insulin Receptor Substrate-1 (pTyr896) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
western blot pricing
I1533 Anti-phospho-Insulin Receptor Substrate-1 (pTyr941) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, human
western blot pricing
SAB4503887 Anti-phospho-IRS-1 (pSer1101) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504442 Anti-phospho-IRS-1 (pSer307) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300653 Anti-phospho-IRS-1 (pSer312) antibody produced in rabbit affinity isolated antibody human, rat, mouse
western blot pricing
SAB4504443 Anti-phospho-IRS-1 (pSer312) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4503927 Anti-phospho-IRS-1 (pSer323) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503888 Anti-phospho-IRS-1 (pSer612) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504444 Anti-phospho-IRS-1 (pSer636) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504032 Anti-phospho-IRS-1 (pSer794) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4504661 Anti-phospho-IRS-1 (pTyr896) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300185 Anti-phospho-IRS1 (pSer636) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300186 Anti-phospho-IRS1 (pSer639) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005544 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
06-248 Anti-IRS1 Antibody Anti-IRS1 Antibody is an antibody against IRS1 for use in IP & WB. pricing
16-257 Anti-IRS1 Antibody, Alexa Fluor® 488 conjugate Detect IRS1 using this Anti-IRS1 Antibody, Alexa Fluor 488 conjugate validated for use in FC, IC & IF. pricing
05-699 Anti-IRS1 Antibody, clone 1M92-7 Anti-IRS1 Antibody, clone 1M92-7 is an antibody against IRS1 for use in IC, IH & IP. pricing
05-784R Anti-IRS1 Antibody, clone 58-10C-31, rabbit monoclonal Detect IRS1 using this Anti-IRS1 Antibody, clone 58-10C-31 validated for use in WB & IP. pricing
04-784 Anti-IRS1 Antibody, clone AW58, rabbit monoclonal Anti-IRS1 Antibody, clone AW58 detects level of IRS1 & has been published & validated for use in IP & WB. pricing
07-848-I Anti-phospho-IRS1 Antibody (Tyr941) Detect IRS1 Tyr941 phosphorylation using this rabbit polyclonal Anti-phospho-IRS1 (Tyr941) antibody, Cat. No. 07-848-I, validated for use in Western Blotting. pricing
09-448 Anti-phospho-IRS1 (Ser612) mouse/ (Ser616) human Antibody Detect phospho-IRS1 (Ser612) mouse/ (Ser616) human using this Anti-phospho-IRS1 (Ser612) mouse/ (Ser616) human Antibody validated for use in WB. pricing
09-432 Anti-phospho-IRS1 (Tyr608) mouse/ (Tyr612) human Antibody Anti-phospho-IRS1 (Tyr608) mouse/ (Tyr612) human Antibody detects level of phospho-IRS1 (Tyr608) mouse/ (Tyr612) human & has been published & validated for use in WB. pricing
09-433 Anti-phospho-IRS1 (Tyr628) mouse/ (Tyr632) human Antibody Anti-phospho-IRS1 (Tyr628) mouse/ (Tyr632) human Antibody is an antibody against phospho-IRS1 (Tyr628) mouse/ (Tyr632) human for use in WB. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005544 Rosetta Predictions human pricing
NM_012969 Rosetta Predictions rat pricing
NM_010570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226939 predicted 1312
2 SASI_Hs01_00226941 predicted 2966
3 SASI_Hs01_00226942 predicted 358
4 SASI_Hs02_00339784 predicted 526
5 SASI_Hs01_00226944 predicted 2422
6 SASI_Hs01_00226946 predicted 1277
7 SASI_Hs01_00226947 predicted 2432
8 SASI_Hs01_00226948 predicted 1248
9 SASI_Hs02_00339785 predicted 1359
10 SASI_Hs02_00339786 predicted 539
11 SASI_Hs01_00226940 predicted 1213
12 SASI_Hs01_00226943 predicted 1068
13 SASI_Hs01_00226945 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105227 predicted 735
2 SASI_Rn01_00105229 predicted 3535
3 SASI_Rn01_00105230 predicted 4080
4 SASI_Rn02_00260570 predicted 1150
5 SASI_Rn01_00105232 predicted 654
6 SASI_Rn01_00105233 predicted 1511
7 SASI_Rn01_00105235 predicted 1042
8 SASI_Rn01_00105236 predicted 833
9 SASI_Rn02_00260571 predicted 2330
10 SASI_Rn02_00260572 predicted 2205
11 SASI_Rn01_00105228 predicted 1225
12 SASI_Rn01_00105231 predicted 4323
13 SASI_Rn01_00105234 predicted 3525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191443 predicted 1085
2 SASI_Mm01_00191445 predicted 2681
3 SASI_Mm01_00191446 predicted 3883
4 SASI_Mm01_00191447 predicted 1012
5 SASI_Mm01_00191448 predicted 2562
6 SASI_Mm01_00191449 predicted 1688
7 SASI_Mm02_00318846 predicted 4445
8 SASI_Mm01_00191450 predicted 4167
9 SASI_Mm01_00191451 predicted 1399
10 SASI_Mm01_00191452 predicted 1192
11 SASI_Mm01_00191444 predicted 4416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010570
VALIDATED
IRS1 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-4572s21c1
Sequence:CCGGGACGCTCCAGTGAGGATTTAACTCGAGTTAAATCCTCACTGGAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-2308s21c1
Sequence:CCGGGGAGGAGCTGAGCAATTATATCTCGAGATATAATTGCTCAGCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-3331s21c1
Sequence:CCGGTACCGCAACTGCCGAAGATTCCTCGAGGAATCTTCGGCAGTTGCGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-7853s21c1
Sequence:CCGGGGTGATAATGATCCCATATTTCTCGAGAAATATGGGATCATTATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010570.4-2224s21c1
Sequence:CCGGTGGTTCTAGTCCCTGCGATTTCTCGAGAAATCGCAGGGACTAGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-4861s1c1
Sequence:CCGGCGGAACAATTAGTGTGCATAACTCGAGTTATGCACACTAATTGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-1189s1c1
Sequence:CCGGCGAGACGAACACTTTGCCATTCTCGAGAATGGCAAAGTGTTCGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-3585s1c1
Sequence:CCGGCCCAGGAGAATATGTGAATATCTCGAGATATTCACATATTCTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-3188s1c1
Sequence:CCGGCGGTCCTCTCTTACTACTCATCTCGAGATGAGTAGTAAGAGAGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-2730s1c1
Sequence:CCGGCCACACTGATGATGGCTATATCTCGAGATATAGCCATCATCAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010570
VALIDATED
IRS1 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-4572s21c1
Sequence:CCGGGACGCTCCAGTGAGGATTTAACTCGAGTTAAATCCTCACTGGAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-2308s21c1
Sequence:CCGGGGAGGAGCTGAGCAATTATATCTCGAGATATAATTGCTCAGCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-3331s21c1
Sequence:CCGGTACCGCAACTGCCGAAGATTCCTCGAGGAATCTTCGGCAGTTGCGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-7853s21c1
Sequence:CCGGGGTGATAATGATCCCATATTTCTCGAGAAATATGGGATCATTATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010570.4-2224s21c1
Sequence:CCGGTGGTTCTAGTCCCTGCGATTTCTCGAGAAATCGCAGGGACTAGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-4861s1c1
Sequence:CCGGCGGAACAATTAGTGTGCATAACTCGAGTTATGCACACTAATTGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-1189s1c1
Sequence:CCGGCGAGACGAACACTTTGCCATTCTCGAGAATGGCAAAGTGTTCGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-3585s1c1
Sequence:CCGGCCCAGGAGAATATGTGAATATCTCGAGATATTCACATATTCTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-3188s1c1
Sequence:CCGGCGGTCCTCTCTTACTACTCATCTCGAGATGAGTAGTAAGAGAGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-2730s1c1
Sequence:CCGGCCACACTGATGATGGCTATATCTCGAGATATAGCCATCATCAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010570
VALIDATED
IRS1 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-4572s21c1
Sequence:CCGGGACGCTCCAGTGAGGATTTAACTCGAGTTAAATCCTCACTGGAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-2308s21c1
Sequence:CCGGGGAGGAGCTGAGCAATTATATCTCGAGATATAATTGCTCAGCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-3331s21c1
Sequence:CCGGTACCGCAACTGCCGAAGATTCCTCGAGGAATCTTCGGCAGTTGCGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010570.4-7853s21c1
Sequence:CCGGGGTGATAATGATCCCATATTTCTCGAGAAATATGGGATCATTATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010570.4-2224s21c1
Sequence:CCGGTGGTTCTAGTCCCTGCGATTTCTCGAGAAATCGCAGGGACTAGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-4861s1c1
Sequence:CCGGCGGAACAATTAGTGTGCATAACTCGAGTTATGCACACTAATTGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-1189s1c1
Sequence:CCGGCGAGACGAACACTTTGCCATTCTCGAGAATGGCAAAGTGTTCGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-3585s1c1
Sequence:CCGGCCCAGGAGAATATGTGAATATCTCGAGATATTCACATATTCTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-3188s1c1
Sequence:CCGGCGGTCCTCTCTTACTACTCATCTCGAGATGAGTAGTAAGAGAGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010570.2-2730s1c1
Sequence:CCGGCCACACTGATGATGGCTATATCTCGAGATATAGCCATCATCAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005544
VALIDATED
IRS1 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-3565s21c1
Sequence:CCGGGGGTTTGGAGAATGGTCTTAACTCGAGTTAAGACCATTCTCCAAACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-2346s21c1
Sequence:GTACCGGACTCATTGCCAAGATCCTTTACTCGAGTAAAGGATCTTGGCAATGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-3711s21c1
Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-1429s21c1
Sequence:CCGGGGAGGAGCTAAGCAACTATATCTCGAGATATAGTTGCTTAGCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005544.2-6233s21c1
Sequence:CCGGGGCATCAAACTACCGATTTAACTCGAGTTAAATCGGTAGTTTGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005544.x-3313s1c1
Sequence:CCGGAGTTCAGAGATCGTTCCTATCTCGAGATAGGAACGATCTCTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005544.x-4768s1c1
Sequence:CCGGCAGAATGAAGACCTAAATGACCTCGAGGTCATTTAGGTCTTCATTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4788s1c1
Sequence:CCGGCCTCAGCAAATCCTCTTCTAACTCGAGTTAGAAGAGGATTTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-3308s1c1
Sequence:CCGGCCTACTACTCATTGCCAAGATCTCGAGATCTTGGCAATGAGTAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4679s1c1
Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-2403s1c1
Sequence:CCGGGCTAAGCAACTATATCTGCATCTCGAGATGCAGATATAGTTGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4044s1c1
Sequence:CCGGCCCTGTAAGCTATGCTGACATCTCGAGATGTCAGCATAGCTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005544
VALIDATED
IRS1 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-3565s21c1
Sequence:CCGGGGGTTTGGAGAATGGTCTTAACTCGAGTTAAGACCATTCTCCAAACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-2346s21c1
Sequence:GTACCGGACTCATTGCCAAGATCCTTTACTCGAGTAAAGGATCTTGGCAATGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-3711s21c1
Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-1429s21c1
Sequence:CCGGGGAGGAGCTAAGCAACTATATCTCGAGATATAGTTGCTTAGCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005544.2-6233s21c1
Sequence:CCGGGGCATCAAACTACCGATTTAACTCGAGTTAAATCGGTAGTTTGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005544.x-3313s1c1
Sequence:CCGGAGTTCAGAGATCGTTCCTATCTCGAGATAGGAACGATCTCTGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005544.x-4768s1c1
Sequence:CCGGCAGAATGAAGACCTAAATGACCTCGAGGTCATTTAGGTCTTCATTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4788s1c1
Sequence:CCGGCCTCAGCAAATCCTCTTCTAACTCGAGTTAGAAGAGGATTTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-3308s1c1
Sequence:CCGGCCTACTACTCATTGCCAAGATCTCGAGATCTTGGCAATGAGTAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4679s1c1
Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-2403s1c1
Sequence:CCGGGCTAAGCAACTATATCTGCATCTCGAGATGCAGATATAGTTGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4044s1c1
Sequence:CCGGCCCTGTAAGCTATGCTGACATCTCGAGATGTCAGCATAGCTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005544
VALIDATED
IRS1 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-3565s21c1
Sequence:CCGGGGGTTTGGAGAATGGTCTTAACTCGAGTTAAGACCATTCTCCAAACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-2346s21c1
Sequence:GTACCGGACTCATTGCCAAGATCCTTTACTCGAGTAAAGGATCTTGGCAATGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-3711s21c1
Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005544.2-1429s21c1
Sequence:CCGGGGAGGAGCTAAGCAACTATATCTCGAGATATAGTTGCTTAGCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005544.2-6233s21c1
Sequence:CCGGGGCATCAAACTACCGATTTAACTCGAGTTAAATCGGTAGTTTGATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005544.x-3313s1c1
Sequence:CCGGAGTTCAGAGATCGTTCCTATCTCGAGATAGGAACGATCTCTGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005544.x-4768s1c1
Sequence:CCGGCAGAATGAAGACCTAAATGACCTCGAGGTCATTTAGGTCTTCATTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039908    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4788s1c1
Sequence:CCGGCCTCAGCAAATCCTCTTCTAACTCGAGTTAGAAGAGGATTTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-3308s1c1
Sequence:CCGGCCTACTACTCATTGCCAAGATCTCGAGATCTTGGCAATGAGTAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4679s1c1
Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-2403s1c1
Sequence:CCGGGCTAAGCAACTATATCTGCATCTCGAGATGCAGATATAGTTGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005544.1-4044s1c1
Sequence:CCGGCCCTGTAAGCTATGCTGACATCTCGAGATGTCAGCATAGCTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)