IRS1

insulin receptor substrate 1

128 Gene Product Result for

Synonyms: HIRS-1

Species: Human IRS1(3667), Mouse Irs1(16367), Rat Irs1(25467), Zebrafish irs1(559281), cow IRS1(538598), domestic cat IRS1(100271862), domestic cat IRS1(101087257), dog IRS1(486148), chicken IRS1(429262), chicken IRS1(101666036), chicken IRS1(101749888), chicken IRS1(429126), sheep IRS1(101102293), Domestic Rabbit IRS1(100339981), domestic guinea pig Irs1(100716939), naked mole-rat Irs1(101708189)

UniProtKB ID: P35568

Gene ID:

Human(3667) Summary: This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]

Mouse(16367) insulin receptor substrate 1

Rat(25467) insulin receptor substrate 1

Zebrafish(559281) insulin receptor substrate 1

cow(538598) insulin receptor substrate 1

domestic cat(100271862) insulin receptor substrate 1

domestic cat(101087257) insulin receptor substrate 1

dog(486148) insulin receptor substrate 1

chicken(429262) insulin receptor substrate 1

chicken(101666036) insulin receptor substrate 1

chicken(101749888) insulin receptor substrate 1

chicken(429126) insulin receptor substrate 1

sheep(101102293) insulin receptor substrate 1

Domestic Rabbit(100339981) insulin receptor substrate 1

domestic guinea pig(100716939) insulin receptor substrate 1

naked mole-rat(101708189) insulin receptor substrate 1

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

I7153	Anti-Insulin Receptor Substrate 1 (IRS-1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	rat, human, mouse	immunoprecipitation (IP), western blot	pricing

SAB4501568	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, immunohistochemistry	pricing

SAB4501569	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunofluorescence, immunohistochemistry	pricing

SAB4501570	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunohistochemistry	pricing

SAB4501571	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4501572	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunohistochemistry	pricing

SAB4501573	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody	rat, mouse, human	ELISA, immunohistochemistry	pricing

SAB3500281	Anti-IRS-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human, mouse	ELISA, immunocytochemistry, western blot	pricing

SAB4300482	Anti-IRS1 (Ab-636) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB4300483	Anti-IRS1 (Ab-639) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	immunofluorescence, western blot	pricing

06-248	Anti-IRS1 Antibody clone, Upstate^®, from rabbit	mouse, human, rat	immunoprecipitation (IP), western blot	pricing

SAB1406045	Anti-IRS1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution	human	western blot	pricing

SAB5700616	Anti-IRS1 antibody produced in rabbit	rat, human, mouse	immunofluorescence, immunohistochemistry, western blot	pricing

HPA046433	Anti-IRS1 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence	pricing

05-784R	Anti-IRS1 Antibody, clone 58-10C-31, rabbit monoclonal clone 58-10C-31, from rabbit	human, mouse, rat, human, mouse, rat	immunoprecipitation (IP), western blot	pricing

04-784	Anti-IRS1 Antibody, clone AW58, rabbit monoclonal culture supernatant, clone AW58, Upstate^®	human, mouse, rat	immunoprecipitation (IP), western blot	pricing

I2533	Anti-phospho-Insulin Receptor Substrate-1 (pSer³¹²) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human	western blot	pricing

I2658	Anti-phospho-Insulin Receptor Substrate-1 (pTyr⁶¹²) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	human	western blot	pricing

I2408	Anti-phospho-Insulin Receptor Substrate-1 (pTyr⁸⁹⁶) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution	rat, human, mouse	western blot	pricing

I1533	Anti-phospho-Insulin Receptor Substrate-1 (pTyr⁹⁴¹) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human, human	western blot	pricing

SAB4503887	Anti-phospho-IRS-1 (pSer¹¹⁰¹) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunohistochemistry, western blot	pricing

SAB4504442	Anti-phospho-IRS-1 (pSer³⁰⁷) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4504443	Anti-phospho-IRS-1 (pSer³¹²) antibody produced in rabbit affinity isolated antibody	human, mouse, rat	ELISA, immunofluorescence, western blot	pricing

SAB4300653	Anti-phospho-IRS-1 (pSer³¹²) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	western blot	pricing

SAB4503927	Anti-phospho-IRS-1 (pSer³²³) antibody produced in rabbit affinity isolated antibody	rat, human, mouse	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4503888	Anti-phospho-IRS-1 (pSer⁶¹²⁾ antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, immunohistochemistry, western blot	pricing

SAB4504444	Anti-phospho-IRS-1 (pSer⁶³⁶) antibody produced in rabbit affinity isolated antibody	mouse, rat, human	ELISA, immunofluorescence, immunohistochemistry, western blot	pricing

SAB4504032	Anti-phospho-IRS-1 (pSer⁷⁹⁴) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, immunohistochemistry	pricing

SAB4504661	Anti-phospho-IRS-1 (pTyr⁸⁹⁶) antibody produced in rabbit affinity isolated antibody	mouse, human, rat	ELISA, western blot	pricing

SAB4300186	Anti-phospho-IRS1 (pSer⁶³⁹) antibody produced in rabbit affinity isolated antibody	rat, mouse, human	immunohistochemistry, western blot	pricing

09-448	Anti-phospho-IRS1 (Ser612) mouse/ (Ser616) human Antibody clone, Upstate^®, from rabbit	human, human, mouse	western blot	pricing

09-432	Anti-phospho-IRS1 (Tyr608) mouse/ (Tyr612) human Antibody clone, Upstate^®, from rabbit	human, human	western blot	pricing

ZRB09432	Anti-phospho-IRS1 (Tyr612) Antibody, clone 1N14, ZooMAb^® Rabbit Monoclonal recombinant, expressed in HEK 293 cells	human, mouse	immunohistochemistry, inhibition assay, western blot	pricing

09-433	Anti-phospho-IRS1 (Tyr628) mouse/ (Tyr632) human Antibody clone, Upstate^®, from rabbit	human, human	western blot	pricing

07-848-I	Anti-phospho-IRS1 Antibody (Tyr941) clone, from rabbit, purified by affinity chromatography	human, human	western blot	pricing

SAB5700515	Anti-Phospho-IRS1-S1101 antibody produced in rabbit	human, mouse	western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP5193	IRS1 (1-355), GST tagged human recombinant, expressed in E. coli, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

SRP5192	IRS1 (600-1245), GST tagged human recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

APREST94121	PrEST Antigen IRS1 Prestige Antigens Powered by Atlas Antibodies	human	pricing

QPREST24227	SILu^™PrEST IRS1 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR07968	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, IRS1	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_010570	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_010570	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_010570	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing
SHCLNG-NM_005544	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_005544	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_005544	MISSION® shRNA Lentiviral Transduction Particles	human	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU033961	MISSION^® esiRNA targeting human AL442003.8-201	human	pricing

EHU020331	MISSION^® esiRNA targeting human IRS1	human	pricing

EMU218141	MISSION^® esiRNA targeting mouse Gm9747, Irs1	mouse	pricing

EMU061331	MISSION^® esiRNA targeting mouse Irs1	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_005544	Rosetta Predictions	human	pricing
NM_012969	Rosetta Predictions	rat	pricing
NM_010570	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_005544	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00226939 predicted	1312
2	SASI_Hs01_00226941 predicted	2966
3	SASI_Hs01_00226942 predicted	358
4	SASI_Hs02_00339784 predicted	526
5	SASI_Hs01_00226944 predicted	2422
6	SASI_Hs01_00226946 predicted	1277
7	SASI_Hs01_00226947 predicted	2432
8	SASI_Hs01_00226948 predicted	1248
9	SASI_Hs02_00339785 predicted	1359
10	SASI_Hs02_00339786 predicted	539
11	SASI_Hs01_00226940 predicted	1213
12	SASI_Hs01_00226943 predicted	1068
13	SASI_Hs01_00226945 predicted	1091

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_012969	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00105227 predicted	735
2	SASI_Rn01_00105229 predicted	3535
3	SASI_Rn01_00105230 predicted	4080
4	SASI_Rn02_00260570 predicted	1150
5	SASI_Rn01_00105232 predicted	654
6	SASI_Rn01_00105233 predicted	1511
7	SASI_Rn01_00105235 predicted	1042
8	SASI_Rn01_00105236 predicted	833
9	SASI_Rn02_00260571 predicted	2330
10	SASI_Rn02_00260572 predicted	2205
11	SASI_Rn01_00105228 predicted	1225
12	SASI_Rn01_00105231 predicted	4323
13	SASI_Rn01_00105234 predicted	3525

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_010570	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm01_00191443 predicted	1085
2	SASI_Mm01_00191445 predicted	2681
3	SASI_Mm01_00191446 predicted	3883
4	SASI_Mm01_00191447 predicted	1012
5	SASI_Mm01_00191448 predicted	2562
6	SASI_Mm01_00191449 predicted	1688
7	SASI_Mm02_00318846 predicted	4445
8	SASI_Mm01_00191450 predicted	4167
9	SASI_Mm01_00191451 predicted	1399
10	SASI_Mm01_00191452 predicted	1192
11	SASI_Mm01_00191444 predicted	4416

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_010570 VALIDATED	IRS1 MISSION shRNA Bacterial Glycerol Stock insulin receptor substrate 1	Mouse

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000244225
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-4572s21c1
	Sequence:CCGGGACGCTCCAGTGAGGATTTAACTCGAGTTAAATCCTCACTGGAGCGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238269
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-2308s21c1
	Sequence:CCGGGGAGGAGCTGAGCAATTATATCTCGAGATATAATTGCTCAGCTCCTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238268
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-3331s21c1
	Sequence:CCGGTACCGCAACTGCCGAAGATTCCTCGAGGAATCTTCGGCAGTTGCGGTATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238266
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-7853s21c1
	Sequence:CCGGGGTGATAATGATCCCATATTTCTCGAGAAATATGGGATCATTATCACCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238267
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010570.4-2224s21c1
	Sequence:CCGGTGGTTCTAGTCCCTGCGATTTCTCGAGAAATCGCAGGGACTAGAACCATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105880
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.53	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-4861s1c1
	Sequence:CCGGCGGAACAATTAGTGTGCATAACTCGAGTTATGCACACTAATTGTTCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105881
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-1189s1c1
	Sequence:CCGGCGAGACGAACACTTTGCCATTCTCGAGAATGGCAAAGTGTTCGTCTCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105882
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-3585s1c1
	Sequence:CCGGCCCAGGAGAATATGTGAATATCTCGAGATATTCACATATTCTCCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105883
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-3188s1c1
	Sequence:CCGGCGGTCCTCTCTTACTACTCATCTCGAGATGAGTAGTAAGAGAGGACCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105884
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-2730s1c1
	Sequence:CCGGCCACACTGATGATGGCTATATCTCGAGATATAGCCATCATCAGTGTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_010570 VALIDATED	IRS1 MISSION shRNA shRNA Plasmid DNA insulin receptor substrate 1	Mouse

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000244225
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-4572s21c1
	Sequence:CCGGGACGCTCCAGTGAGGATTTAACTCGAGTTAAATCCTCACTGGAGCGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000238269
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-2308s21c1
	Sequence:CCGGGGAGGAGCTGAGCAATTATATCTCGAGATATAATTGCTCAGCTCCTCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000238268
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-3331s21c1
	Sequence:CCGGTACCGCAACTGCCGAAGATTCCTCGAGGAATCTTCGGCAGTTGCGGTATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000238266
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-7853s21c1
	Sequence:CCGGGGTGATAATGATCCCATATTTCTCGAGAAATATGGGATCATTATCACCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000238267
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010570.4-2224s21c1
	Sequence:CCGGTGGTTCTAGTCCCTGCGATTTCTCGAGAAATCGCAGGGACTAGAACCATTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000105880
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.53	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-4861s1c1
	Sequence:CCGGCGGAACAATTAGTGTGCATAACTCGAGTTATGCACACTAATTGTTCCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000105881
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-1189s1c1
	Sequence:CCGGCGAGACGAACACTTTGCCATTCTCGAGAATGGCAAAGTGTTCGTCTCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000105882
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-3585s1c1
	Sequence:CCGGCCCAGGAGAATATGTGAATATCTCGAGATATTCACATATTCTCCTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000105883
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-3188s1c1
	Sequence:CCGGCGGTCCTCTCTTACTACTCATCTCGAGATGAGTAGTAAGAGAGGACCGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000105884
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-2730s1c1
	Sequence:CCGGCCACACTGATGATGGCTATATCTCGAGATATAGCCATCATCAGTGTGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_010570 VALIDATED	IRS1 MISSION shRNA Lentiviral Transduction Particles insulin receptor substrate 1	Mouse

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000244225
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.78	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-4572s21c1
	Sequence:CCGGGACGCTCCAGTGAGGATTTAACTCGAGTTAAATCCTCACTGGAGCGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238269
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-2308s21c1
	Sequence:CCGGGGAGGAGCTGAGCAATTATATCTCGAGATATAATTGCTCAGCTCCTCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238268
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.64	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-3331s21c1
	Sequence:CCGGTACCGCAACTGCCGAAGATTCCTCGAGGAATCTTCGGCAGTTGCGGTATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238266
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_010570.4-7853s21c1
	Sequence:CCGGGGTGATAATGATCCCATATTTCTCGAGAAATATGGGATCATTATCACCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000238267
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_010570.4-2224s21c1
	Sequence:CCGGTGGTTCTAGTCCCTGCGATTTCTCGAGAAATCGCAGGGACTAGAACCATTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105880
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.53	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-4861s1c1
	Sequence:CCGGCGGAACAATTAGTGTGCATAACTCGAGTTATGCACACTAATTGTTCCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105881
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.68	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-1189s1c1
	Sequence:CCGGCGAGACGAACACTTTGCCATTCTCGAGAATGGCAAAGTGTTCGTCTCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105882
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.54	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-3585s1c1
	Sequence:CCGGCCCAGGAGAATATGTGAATATCTCGAGATATTCACATATTCTCCTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105883
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.66	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-3188s1c1
	Sequence:CCGGCGGTCCTCTCTTACTACTCATCTCGAGATGAGTAGTAAGAGAGGACCGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000105884
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.5	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_010570.2-2730s1c1
	Sequence:CCGGCCACACTGATGATGGCTATATCTCGAGATATAGCCATCATCAGTGTGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_005544 VALIDATED	IRS1 MISSION shRNA Bacterial Glycerol Stock insulin receptor substrate 1	Human

12 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000231149
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-3565s21c1
	Sequence:CCGGGGGTTTGGAGAATGGTCTTAACTCGAGTTAAGACCATTCTCCAAACCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218908
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-2346s21c1
	Sequence:GTACCGGACTCATTGCCAAGATCCTTTACTCGAGTAAAGGATCTTGGCAATGAGTTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000231150
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-3711s21c1
	Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000231148
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-1429s21c1
	Sequence:CCGGGGAGGAGCTAAGCAACTATATCTCGAGATATAGTTGCTTAGCTCCTCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000231151
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_005544.2-6233s21c1
	Sequence:CCGGGGCATCAAACTACCGATTTAACTCGAGTTAAATCGGTAGTTTGATGCCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009843
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005544.x-3313s1c1
	Sequence:CCGGAGTTCAGAGATCGTTCCTATCTCGAGATAGGAACGATCTCTGAACTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009844
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005544.x-4768s1c1
	Sequence:CCGGCAGAATGAAGACCTAAATGACCTCGAGGTCATTTAGGTCTTCATTCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039908
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4788s1c1
	Sequence:CCGGCCTCAGCAAATCCTCTTCTAACTCGAGTTAGAAGAGGATTTGCTGAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039912
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-3308s1c1
	Sequence:CCGGCCTACTACTCATTGCCAAGATCTCGAGATCTTGGCAATGAGTAGTAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039909
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4679s1c1
	Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039911
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-2403s1c1
	Sequence:CCGGGCTAAGCAACTATATCTGCATCTCGAGATGCAGATATAGTTGCTTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039910
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4044s1c1
	Sequence:CCGGCCCTGTAAGCTATGCTGACATCTCGAGATGTCAGCATAGCTTACAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_005544 VALIDATED	IRS1 MISSION shRNA shRNA Plasmid DNA insulin receptor substrate 1	Human

12 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000231149
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-3565s21c1
	Sequence:CCGGGGGTTTGGAGAATGGTCTTAACTCGAGTTAAGACCATTCTCCAAACCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000218908
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-2346s21c1
	Sequence:GTACCGGACTCATTGCCAAGATCCTTTACTCGAGTAAAGGATCTTGGCAATGAGTTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000231150
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-3711s21c1
	Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000231148
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-1429s21c1
	Sequence:CCGGGGAGGAGCTAAGCAACTATATCTCGAGATATAGTTGCTTAGCTCCTCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000231151
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_005544.2-6233s21c1
	Sequence:CCGGGGCATCAAACTACCGATTTAACTCGAGTTAAATCGGTAGTTTGATGCCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000009843
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005544.x-3313s1c1
	Sequence:CCGGAGTTCAGAGATCGTTCCTATCTCGAGATAGGAACGATCTCTGAACTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000009844
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005544.x-4768s1c1
	Sequence:CCGGCAGAATGAAGACCTAAATGACCTCGAGGTCATTTAGGTCTTCATTCTGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039908
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4788s1c1
	Sequence:CCGGCCTCAGCAAATCCTCTTCTAACTCGAGTTAGAAGAGGATTTGCTGAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039912
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-3308s1c1
	Sequence:CCGGCCTACTACTCATTGCCAAGATCTCGAGATCTTGGCAATGAGTAGTAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039909
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4679s1c1
	Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039911
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-2403s1c1
	Sequence:CCGGGCTAAGCAACTATATCTGCATCTCGAGATGCAGATATAGTTGCTTAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000039910
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4044s1c1
	Sequence:CCGGCCCTGTAAGCTATGCTGACATCTCGAGATGTCAGCATAGCTTACAGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_005544 VALIDATED	IRS1 MISSION shRNA Lentiviral Transduction Particles insulin receptor substrate 1	Human

12 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000231149
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.89	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-3565s21c1
	Sequence:CCGGGGGTTTGGAGAATGGTCTTAACTCGAGTTAAGACCATTCTCCAAACCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218908
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-2346s21c1
	Sequence:GTACCGGACTCATTGCCAAGATCCTTTACTCGAGTAAAGGATCTTGGCAATGAGTTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000231150
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.94	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-3711s21c1
	Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000231148
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.52	Cell Line: A549
	TRC Version: 2	Clone ID:NM_005544.2-1429s21c1
	Sequence:CCGGGGAGGAGCTAAGCAACTATATCTCGAGATATAGTTGCTTAGCTCCTCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000231151
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_005544.2-6233s21c1
	Sequence:CCGGGGCATCAAACTACCGATTTAACTCGAGTTAAATCGGTAGTTTGATGCCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009843
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_005544.x-3313s1c1
	Sequence:CCGGAGTTCAGAGATCGTTCCTATCTCGAGATAGGAACGATCTCTGAACTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000009844
Product Details	Region:3UTR
	TRC Version: 1	Clone ID:NM_005544.x-4768s1c1
	Sequence:CCGGCAGAATGAAGACCTAAATGACCTCGAGGTCATTTAGGTCTTCATTCTGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039908
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.97	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4788s1c1
	Sequence:CCGGCCTCAGCAAATCCTCTTCTAACTCGAGTTAGAAGAGGATTTGCTGAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039912
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.53	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-3308s1c1
	Sequence:CCGGCCTACTACTCATTGCCAAGATCTCGAGATCTTGGCAATGAGTAGTAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039909
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4679s1c1
	Sequence:CCGGGCCGCTCAAGTGAGGATTTAACTCGAGTTAAATCCTCACTTGAGCGGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039911
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.58	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-2403s1c1
	Sequence:CCGGGCTAAGCAACTATATCTGCATCTCGAGATGCAGATATAGTTGCTTAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000039910
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: A549
	TRC Version: 1	Clone ID:NM_005544.1-4044s1c1
	Sequence:CCGGCCCTGTAAGCTATGCTGACATCTCGAGATGTCAGCATAGCTTACAGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart