EMAIL THIS PAGE TO A FRIEND

IRS2

insulin receptor substrate 2

204 Gene Product Result for
Synonyms: IRS-2
UniProtKB ID: Q9Y4H2, Q96RR2, Q9BZG0, Q9Y6I5
Gene ID:
Human(8660) Summary: This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
Mouse(384783) insulin receptor substrate 2
Rat(29376) insulin receptor substrate 2
domestic guinea pig(100730395) insulin receptor substrate 2
naked mole-rat(101719081) insulin receptor substrate 2
Zebrafish(572001) insulin receptor substrate 2
cow(100300012) insulin receptor substrate 2
Horse(100146249) insulin receptor substrate 2
domestic cat(100271863) insulin receptor substrate 2
chicken(428017) insulin receptor substrate 2
dog(485548) insulin receptor substrate 2
domestic cat(101095791) insulin receptor substrate 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003749 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003749 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003749 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_357863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_357863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_357863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU187631 MISSION® esiRNA esiRNA targeting mouse Irs2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003749 Rosetta Predictions human pricing
XM_001076309 Rosetta Predictions rat pricing
XM_573948 Rosetta Predictions rat pricing
NM_001081212 Rosetta Predictions mouse pricing
XM_357863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053497 predicted 2125
2 SASI_Hs01_00053498 predicted 4562
3 SASI_Hs01_00053500 predicted 4635
4 SASI_Hs01_00053502 predicted 4940
5 SASI_Hs01_00053503 predicted 4554
6 SASI_Hs01_00053504 predicted 3718
7 SASI_Hs01_00053505 predicted 2749
8 SASI_Hs02_00336214 predicted 1996
9 SASI_Hs01_00053506 predicted 1382
10 SASI_Hs02_00336215 predicted 4532
11 SASI_Hs01_00053499 predicted 4533
12 SASI_Hs01_00053501 predicted 4923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076309 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352799 predicted 3463
2 SASI_Rn02_00352800 predicted 618
3 SASI_Rn02_00352801 predicted 1607
4 SASI_Rn02_00352802 predicted 1891
5 SASI_Rn02_00352803 predicted 4063
6 SASI_Rn02_00352804 predicted 2136
7 SASI_Rn02_00352805 predicted 1478
8 SASI_Rn02_00352806 predicted 630
9 SASI_Rn02_00352807 predicted 2735
10 SASI_Rn02_00352808 predicted 2393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401075 predicted 3471
2 SASI_Rn02_00401076 predicted 614
3 SASI_Rn02_00401077 predicted 1605
4 SASI_Rn02_00401078 predicted 1889
5 SASI_Rn02_00401079 predicted 4067
6 SASI_Rn02_00401080 predicted 2137
7 SASI_Rn02_00401081 predicted 1480
8 SASI_Rn02_00401082 predicted 630
9 SASI_Rn02_00401083 predicted 2728
10 SASI_Rn02_00401084 predicted 2393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296281 predicted 615
2 SASI_Mm02_00296282 predicted 861
3 SASI_Mm02_00296283 predicted 1885
4 SASI_Mm02_00296284 predicted 1475
5 SASI_Mm02_00296285 predicted 1541
6 SASI_Mm02_00296286 predicted 2731
7 SASI_Mm02_00296287 predicted 2725
8 SASI_Mm02_00296288 predicted 1903
9 SASI_Mm02_00296289 predicted 2428
10 SASI_Mm02_00296290 predicted 3719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_357863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242056 predicted 617
2 SASI_Mm01_00242057 predicted 870
3 SASI_Mm01_00242058 predicted 1899
4 SASI_Mm01_00242059 predicted 1541
5 SASI_Mm01_00242060 predicted 2734
6 SASI_Mm01_00242061 predicted 2731
7 SASI_Mm01_00242062 predicted 2430
8 SASI_Mm01_00242063 predicted 1908
9 SASI_Mm01_00242064 predicted 2438
10 SASI_Mm01_00242065 predicted 3721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003749
VALIDATED
IRS2 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003749.2-2296s1c1
Sequence:CCGGGCTGGATGAATACACCCTGATCTCGAGATCAGGGTGTATTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-4514s21c1
Sequence:CCGGACCATCGTGAAAGAGTGAAGACTCGAGTCTTCACTCTTTCACGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003749.2-4563s21c1
Sequence:CCGGCATGTCAGAGAGTATCATTAACTCGAGTTAATGATACTCTCTGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003749.2-3265s1c1
Sequence:CCGGCGAGTACATCAACATCGACTTCTCGAGAAGTCGATGTTGATGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003749.2-2398s1c1
Sequence:CCGGCCCAGAGGACTACGGAGACATCTCGAGATGTCTCCGTAGTCCTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-3431s21c1
Sequence:CCGGTCTCCGCTCTCCGACTACATGCTCGAGCATGTAGTCGGAGAGCGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003749.2-4528s21c1
Sequence:CCGGGTGAAGATCTGTCTGGCTTTACTCGAGTAAAGCCAGACAGATCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-2296s21c1
Sequence:CCGGGCTGGATGAATACACCCTGATCTCGAGATCAGGGTGTATTCATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003749
VALIDATED
IRS2 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003749.2-2296s1c1
Sequence:CCGGGCTGGATGAATACACCCTGATCTCGAGATCAGGGTGTATTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-4514s21c1
Sequence:CCGGACCATCGTGAAAGAGTGAAGACTCGAGTCTTCACTCTTTCACGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003749.2-4563s21c1
Sequence:CCGGCATGTCAGAGAGTATCATTAACTCGAGTTAATGATACTCTCTGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003749.2-3265s1c1
Sequence:CCGGCGAGTACATCAACATCGACTTCTCGAGAAGTCGATGTTGATGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003749.2-2398s1c1
Sequence:CCGGCCCAGAGGACTACGGAGACATCTCGAGATGTCTCCGTAGTCCTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-3431s21c1
Sequence:CCGGTCTCCGCTCTCCGACTACATGCTCGAGCATGTAGTCGGAGAGCGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003749.2-4528s21c1
Sequence:CCGGGTGAAGATCTGTCTGGCTTTACTCGAGTAAAGCCAGACAGATCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-2296s21c1
Sequence:CCGGGCTGGATGAATACACCCTGATCTCGAGATCAGGGTGTATTCATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003749
VALIDATED
IRS2 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003749.2-2296s1c1
Sequence:CCGGGCTGGATGAATACACCCTGATCTCGAGATCAGGGTGTATTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-4514s21c1
Sequence:CCGGACCATCGTGAAAGAGTGAAGACTCGAGTCTTCACTCTTTCACGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003749.2-4563s21c1
Sequence:CCGGCATGTCAGAGAGTATCATTAACTCGAGTTAATGATACTCTCTGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003749.2-3265s1c1
Sequence:CCGGCGAGTACATCAACATCGACTTCTCGAGAAGTCGATGTTGATGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_003749.2-2398s1c1
Sequence:CCGGCCCAGAGGACTACGGAGACATCTCGAGATGTCTCCGTAGTCCTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-3431s21c1
Sequence:CCGGTCTCCGCTCTCCGACTACATGCTCGAGCATGTAGTCGGAGAGCGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003749.2-4528s21c1
Sequence:CCGGGTGAAGATCTGTCTGGCTTTACTCGAGTAAAGCCAGACAGATCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003749.2-2296s21c1
Sequence:CCGGGCTGGATGAATACACCCTGATCTCGAGATCAGGGTGTATTCATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_357863
VALIDATED
IRS2 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357863.2-51s1c1
Sequence:CCGGCCCGAACCTCAATAACAACAACTCGAGTTGTTGTTATTGAGGTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357863.2-2727s1c1
Sequence:CCGGCGAGTACATCAACATTGACTTCTCGAGAAGTCAATGTTGATGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-3714s1c1
Sequence:CCGGCGGCCTCAACTATATCGCCATCTCGAGATGGCGATATAGTTGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-856s1c1
Sequence:CCGGGAAGCTATGAAGGCACTCAAACTCGAGTTTGAGTGCCTTCATAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-2396s1c1
Sequence:CCGGGCTCTTATAAGGCTCCCTGTTCTCGAGAACAGGGAGCCTTATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_357863
VALIDATED
IRS2 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357863.2-51s1c1
Sequence:CCGGCCCGAACCTCAATAACAACAACTCGAGTTGTTGTTATTGAGGTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357863.2-2727s1c1
Sequence:CCGGCGAGTACATCAACATTGACTTCTCGAGAAGTCAATGTTGATGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-3714s1c1
Sequence:CCGGCGGCCTCAACTATATCGCCATCTCGAGATGGCGATATAGTTGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-856s1c1
Sequence:CCGGGAAGCTATGAAGGCACTCAAACTCGAGTTTGAGTGCCTTCATAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-2396s1c1
Sequence:CCGGGCTCTTATAAGGCTCCCTGTTCTCGAGAACAGGGAGCCTTATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_357863
VALIDATED
IRS2 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357863.2-51s1c1
Sequence:CCGGCCCGAACCTCAATAACAACAACTCGAGTTGTTGTTATTGAGGTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_357863.2-2727s1c1
Sequence:CCGGCGAGTACATCAACATTGACTTCTCGAGAAGTCAATGTTGATGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-3714s1c1
Sequence:CCGGCGGCCTCAACTATATCGCCATCTCGAGATGGCGATATAGTTGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-856s1c1
Sequence:CCGGGAAGCTATGAAGGCACTCAAACTCGAGTTTGAGTGCCTTCATAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_357863.2-2396s1c1
Sequence:CCGGGCTCTTATAAGGCTCCCTGTTCTCGAGAACAGGGAGCCTTATAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081212
VALIDATED
IRS2 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000362967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081212.1-2723s21c1
Sequence:CCGGCTGGCGAGTACATCAACATTGCTCGAGCAATGTTGATGTACTCGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081212.1-1481s21c1
Sequence:CCGGTCATGTCCCTTGACGAGTATGCTCGAGCATACTCGTCAAGGGACATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081212.1-3709s21c1
Sequence:CCGGCAGAACGGCCTCAACTATATCCTCGAGGATATAGTTGAGGCCGTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081212.1-2893s21c1
Sequence:CCGGTCTCCACTCTCTGACTATATGCTCGAGCATATAGTCAGAGAGTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081212
VALIDATED
IRS2 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000362967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081212.1-2723s21c1
Sequence:CCGGCTGGCGAGTACATCAACATTGCTCGAGCAATGTTGATGTACTCGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081212.1-1481s21c1
Sequence:CCGGTCATGTCCCTTGACGAGTATGCTCGAGCATACTCGTCAAGGGACATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081212.1-3709s21c1
Sequence:CCGGCAGAACGGCCTCAACTATATCCTCGAGGATATAGTTGAGGCCGTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081212.1-2893s21c1
Sequence:CCGGTCTCCACTCTCTGACTATATGCTCGAGCATATAGTCAGAGAGTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081212
VALIDATED
IRS2 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000362967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081212.1-2723s21c1
Sequence:CCGGCTGGCGAGTACATCAACATTGCTCGAGCAATGTTGATGTACTCGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081212.1-1481s21c1
Sequence:CCGGTCATGTCCCTTGACGAGTATGCTCGAGCATACTCGTCAAGGGACATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081212.1-3709s21c1
Sequence:CCGGCAGAACGGCCTCAACTATATCCTCGAGGATATAGTTGAGGCCGTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081212.1-2893s21c1
Sequence:CCGGTCTCCACTCTCTGACTATATGCTCGAGCATATAGTCAGAGAGTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)