EMAIL THIS PAGE TO A FRIEND

IRS4

insulin receptor substrate 4

57 Gene Product Result for
Synonyms: IRS-4 PY160
UniProtKB ID: O14654
Gene ID:
Human(8471) Summary: IRS4 encodes the insulin receptor substrate 4, a cytoplasmic protein that contains many potential tyrosine and serine/threonine phosphorylation sites. Tyrosine-phosphorylated IRS4 protein has been shown to associate with cytoplasmic signalling molecules that contain SH2 domains. The IRS4 protein is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation.. [provided by RefSeq, Jul 2008]
Mouse(16370) insulin receptor substrate 4
Rat(315350) insulin receptor substrate 4
dog(492059) insulin receptor substrate 4
cow(514607) insulin receptor substrate 4
domestic guinea pig(100717360) insulin receptor substrate 4
sheep(101112456) insulin receptor substrate 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010572 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010572 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010572 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003604 Rosetta Predictions human pricing
XM_001056753 Rosetta Predictions rat pricing
XM_235721 Rosetta Predictions rat pricing
NM_010572 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140696 predicted 354
2 SASI_Hs01_00140697 predicted 2812
3 SASI_Hs01_00140698 predicted 3651
4 SASI_Hs02_00335940 predicted 2828
5 SASI_Hs01_00140699 predicted 510
6 SASI_Hs01_00140700 predicted 3562
7 SASI_Hs01_00140701 predicted 2601
8 SASI_Hs01_00140703 predicted 1524
9 SASI_Hs01_00140704 predicted 2292
10 SASI_Hs02_00335941 predicted 775
11 SASI_Hs01_00140702 predicted 2912
12 SASI_Hs01_00140705 predicted 3119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284316 predicted 1307
2 SASI_Rn02_00284317 predicted 3016
3 SASI_Rn02_00284318 predicted 3015
4 SASI_Rn02_00284319 predicted 1483
5 SASI_Rn02_00284320 predicted 3952
6 SASI_Rn02_00284321 predicted 3696
7 SASI_Rn02_00284322 predicted 1065
8 SASI_Rn02_00284323 predicted 2590
9 SASI_Rn02_00284324 predicted 871
10 SASI_Rn02_00284325 predicted 3121
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389636 predicted 3378
2 SASI_Rn02_00389637 predicted 832
3 SASI_Rn02_00389638 predicted 1667
4 SASI_Rn02_00389639 predicted 3822
5 SASI_Rn02_00389640 predicted 3566
6 SASI_Rn02_00389641 predicted 3444
7 SASI_Rn02_00389642 predicted 1562
8 SASI_Rn02_00389643 predicted 3864
9 SASI_Rn02_00389644 predicted 1092
10 SASI_Rn02_00389645 predicted 3283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010572 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129045 predicted 1780
2 SASI_Mm01_00129046 predicted 805
3 SASI_Mm01_00129047 predicted 2960
4 SASI_Mm01_00129048 predicted 3630
5 SASI_Mm01_00129049 predicted 1715
6 SASI_Mm01_00129050 predicted 1934
7 SASI_Mm01_00129051 predicted 1985
8 SASI_Mm01_00129052 predicted 3158
9 SASI_Mm01_00129053 predicted 2702
10 SASI_Mm02_00318847 predicted 1071
11 SASI_Mm01_00129054 predicted 3032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010572
IRS4 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 4
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000105820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010572.2-5290s1c1
Sequence:CCGGCCGAGTTGATTTCTATTGTTTCTCGAGAAACAATAGAAATCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010572.2-344s1c1
Sequence:CCGGCGACTCGAATACTACCGAAATCTCGAGATTTCGGTAGTATTCGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010572.2-2000s1c1
Sequence:CCGGGCCAGAGCTTTCGATGAAGATCTCGAGATCTTCATCGAAAGCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010572
IRS4 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 4
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000105820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010572.2-5290s1c1
Sequence:CCGGCCGAGTTGATTTCTATTGTTTCTCGAGAAACAATAGAAATCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010572.2-344s1c1
Sequence:CCGGCGACTCGAATACTACCGAAATCTCGAGATTTCGGTAGTATTCGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010572.2-2000s1c1
Sequence:CCGGGCCAGAGCTTTCGATGAAGATCTCGAGATCTTCATCGAAAGCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010572
IRS4 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 4
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000105820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010572.2-5290s1c1
Sequence:CCGGCCGAGTTGATTTCTATTGTTTCTCGAGAAACAATAGAAATCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010572.2-344s1c1
Sequence:CCGGCGACTCGAATACTACCGAAATCTCGAGATTTCGGTAGTATTCGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010572.2-2000s1c1
Sequence:CCGGGCCAGAGCTTTCGATGAAGATCTCGAGATCTTCATCGAAAGCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003604
IRS4 MISSION shRNA Bacterial Glycerol Stock
insulin receptor substrate 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-2362s1c1
Sequence:CCGGCCTGATACTAATAAAGAGGATCTCGAGATCCTCTTTATTAGTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-2565s1c1
Sequence:CCGGGCCAATGTTACCTGGAAAGTTCTCGAGAACTTTCCAGGTAACATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-3182s1c1
Sequence:CCGGCCATTCGCTATGATGCTGAAACTCGAGTTTCAGCATCATAGCGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-3560s1c1
Sequence:CCGGGCTGGTTTCAACCTGTTGCTACTCGAGTAGCAACAGGTTGAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-398s1c1
Sequence:CCGGCTCGGCTGGAATACTACGAAACTCGAGTTTCGTAGTATTCCAGCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003604.2-2691s21c1
Sequence:CCGGTAAGAGACCTAACCGACTTTCCTCGAGGAAAGTCGGTTAGGTCTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003604.2-1418s21c1
Sequence:CCGGGTTCTGGCTCTGGCAACTTTGCTCGAGCAAAGTTGCCAGAGCCAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003604
IRS4 MISSION shRNA shRNA Plasmid DNA
insulin receptor substrate 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-2362s1c1
Sequence:CCGGCCTGATACTAATAAAGAGGATCTCGAGATCCTCTTTATTAGTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-2565s1c1
Sequence:CCGGGCCAATGTTACCTGGAAAGTTCTCGAGAACTTTCCAGGTAACATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-3182s1c1
Sequence:CCGGCCATTCGCTATGATGCTGAAACTCGAGTTTCAGCATCATAGCGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-3560s1c1
Sequence:CCGGGCTGGTTTCAACCTGTTGCTACTCGAGTAGCAACAGGTTGAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-398s1c1
Sequence:CCGGCTCGGCTGGAATACTACGAAACTCGAGTTTCGTAGTATTCCAGCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003604.2-2691s21c1
Sequence:CCGGTAAGAGACCTAACCGACTTTCCTCGAGGAAAGTCGGTTAGGTCTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003604.2-1418s21c1
Sequence:CCGGGTTCTGGCTCTGGCAACTTTGCTCGAGCAAAGTTGCCAGAGCCAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003604
IRS4 MISSION shRNA Lentiviral Transduction Particles
insulin receptor substrate 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-2362s1c1
Sequence:CCGGCCTGATACTAATAAAGAGGATCTCGAGATCCTCTTTATTAGTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-2565s1c1
Sequence:CCGGGCCAATGTTACCTGGAAAGTTCTCGAGAACTTTCCAGGTAACATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-3182s1c1
Sequence:CCGGCCATTCGCTATGATGCTGAAACTCGAGTTTCAGCATCATAGCGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-3560s1c1
Sequence:CCGGGCTGGTTTCAACCTGTTGCTACTCGAGTAGCAACAGGTTGAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003604.1-398s1c1
Sequence:CCGGCTCGGCTGGAATACTACGAAACTCGAGTTTCGTAGTATTCCAGCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003604.2-2691s21c1
Sequence:CCGGTAAGAGACCTAACCGACTTTCCTCGAGGAAAGTCGGTTAGGTCTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003604.2-1418s21c1
Sequence:CCGGGTTCTGGCTCTGGCAACTTTGCTCGAGCAAAGTTGCCAGAGCCAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)