EMAIL THIS PAGE TO A FRIEND

IRX1

iroquois homeobox 1

52 Gene Product Result for
Synonyms: IRX-5 IRXA1
UniProtKB ID: P78414, Q7Z2F8, Q8N312
Gene ID:
Human(79192) Summary: This gene encodes a member of the Iroquois homeobox protein family. Homeobox genes in this family are involved in pattern formation in the embryo. The gene product has been identified as a tumor suppressor in gastric (PMID: 21602894, 20440264) and head and neck cancers (PMID: 18559491). A pseudogene of this gene is located on chromosome 13. [provided by RefSeq, Dec 2011]
Mouse(16371) Iroquois related homeobox 1 (Drosophila)
Rat(306659) iroquois homeobox 1
Thale Cress(827612) cellulose synthase A catalytic subunit 8 [UDP-forming]
domestic cat(101100369) iroquois homeobox 1
cow(783235) iroquois homeobox 1
dog(100687341) iroquois homeobox 1
chicken(374185) iroquois homeobox 1
domestic guinea pig(100717508) iroquois homeobox 1
naked mole-rat(101712473) iroquois homeobox 1
sheep(101108256) iroquois homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33572 Anti-IRX1 (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, mouse, rat, human, chicken, zebrafish, bovine,
western blot pricing
AV47680 Anti-IRX1 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, human, rabbit, zebrafish, mouse, guinea pig, bovine, rat, horse
western blot pricing
SAB2107903 Anti-IRX1 antibody produced in rabbit IgG fraction of antiserum mouse, horse, human, rat, rabbit, guinea pig, zebrafish, bovine, canine
western blot pricing
SAB2105092 Anti-IRX1 antibody produced in rabbit affinity isolated antibody human, rat, guinea pig, mouse, rabbit, horse
western blot pricing
SAB2105093 Anti-IRX1 antibody produced in rabbit affinity isolated antibody human, mouse, horse, rat, rabbit, guinea pig
western blot pricing
SAB4503145 Anti-IRX1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
HPA043160 Anti-IRX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_380171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_380171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_380171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024337 Rosetta Predictions human pricing
NM_001107331 Rosetta Predictions rat pricing
NM_010573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223025 predicted 659
2 SASI_Hs01_00223026 predicted 713
3 SASI_Hs01_00223027 predicted 719
4 SASI_Hs01_00223028 predicted 687
5 SASI_Hs01_00223029 predicted 1484
6 SASI_Hs01_00223030 predicted 1578
7 SASI_Hs01_00223031 predicted 1576
8 SASI_Hs01_00223032 predicted 1769
9 SASI_Hs01_00223033 predicted 1378
10 SASI_Hs01_00223034 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227785 predicted 616
2 SASI_Rn02_00227786 predicted 543
3 SASI_Rn02_00227787 predicted 1981
4 SASI_Rn02_00227788 predicted 603
5 SASI_Rn02_00227789 predicted 2054
6 SASI_Rn02_00227790 predicted 1954
7 SASI_Rn02_00227791 predicted 1405
8 SASI_Rn02_00227792 predicted 1363
9 SASI_Rn02_00227793 predicted 2029
10 SASI_Rn02_00227794 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079819 predicted 581
2 SASI_Mm01_00079820 predicted 642
3 SASI_Mm01_00079821 predicted 910
4 SASI_Mm01_00079822 predicted 1325
5 SASI_Mm01_00079823 predicted 1315
6 SASI_Mm01_00079824 predicted 568
7 SASI_Mm01_00079825 predicted 498
8 SASI_Mm01_00079826 predicted 560
9 SASI_Mm01_00079827 predicted 495
10 SASI_Mm01_00079828 predicted 1385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010573
VALIDATED
IRX1 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010573.1-1152s1c1
Sequence:CCGGGCTGCTGAACATGCGATCTTTCTCGAGAAAGATCGCATGTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-216s1c1
Sequence:CCGGCGCACCCAACTACAGCGCCTTCTCGAGAAGGCGCTGTAGTTGGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010573.1-678s1c1
Sequence:CCGGGAGCATTGACATCGATCAGATCTCGAGATCTGATCGATGTCAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-817s1c1
Sequence:CCGGGAGACACTCAAGTCTCAAGATCTCGAGATCTTGAGACTTGAGTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-333s1c1
Sequence:CCGGCCACACAACGCCTGCTTATTACTCGAGTAATAAGCAGGCGTTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010573
VALIDATED
IRX1 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010573.1-1152s1c1
Sequence:CCGGGCTGCTGAACATGCGATCTTTCTCGAGAAAGATCGCATGTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-216s1c1
Sequence:CCGGCGCACCCAACTACAGCGCCTTCTCGAGAAGGCGCTGTAGTTGGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010573.1-678s1c1
Sequence:CCGGGAGCATTGACATCGATCAGATCTCGAGATCTGATCGATGTCAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-817s1c1
Sequence:CCGGGAGACACTCAAGTCTCAAGATCTCGAGATCTTGAGACTTGAGTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-333s1c1
Sequence:CCGGCCACACAACGCCTGCTTATTACTCGAGTAATAAGCAGGCGTTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010573
VALIDATED
IRX1 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010573.1-1152s1c1
Sequence:CCGGGCTGCTGAACATGCGATCTTTCTCGAGAAAGATCGCATGTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-216s1c1
Sequence:CCGGCGCACCCAACTACAGCGCCTTCTCGAGAAGGCGCTGTAGTTGGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010573.1-678s1c1
Sequence:CCGGGAGCATTGACATCGATCAGATCTCGAGATCTGATCGATGTCAATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-817s1c1
Sequence:CCGGGAGACACTCAAGTCTCAAGATCTCGAGATCTTGAGACTTGAGTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010573.1-333s1c1
Sequence:CCGGCCACACAACGCCTGCTTATTACTCGAGTAATAAGCAGGCGTTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380171
IRX1 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-739s1c1
Sequence:CCGGCATTGACAAGATCGACGAGCACTCGAGTGCTCGTCGATCTTGTCAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-721s1c1
Sequence:CCGGCGACCTGGAAAGCATCGACATCTCGAGATGTCGATGCTTTCCAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-307s1c1
Sequence:CCGGTCTCAGCCTCTTCTCGCAGATCTCGAGATCTGCGAGAAGAGGCTGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-1204s1c1
Sequence:CCGGCCTGCTCAACATGCGCTCCTTCTCGAGAAGGAGCGCATGTTGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-1144s1c1
Sequence:CCGGCACCTGCCACATCGGCAAGTTCTCGAGAACTTGCCGATGTGGCAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380171
IRX1 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-739s1c1
Sequence:CCGGCATTGACAAGATCGACGAGCACTCGAGTGCTCGTCGATCTTGTCAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-721s1c1
Sequence:CCGGCGACCTGGAAAGCATCGACATCTCGAGATGTCGATGCTTTCCAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-307s1c1
Sequence:CCGGTCTCAGCCTCTTCTCGCAGATCTCGAGATCTGCGAGAAGAGGCTGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-1204s1c1
Sequence:CCGGCCTGCTCAACATGCGCTCCTTCTCGAGAAGGAGCGCATGTTGAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-1144s1c1
Sequence:CCGGCACCTGCCACATCGGCAAGTTCTCGAGAACTTGCCGATGTGGCAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380171
IRX1 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-739s1c1
Sequence:CCGGCATTGACAAGATCGACGAGCACTCGAGTGCTCGTCGATCTTGTCAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-721s1c1
Sequence:CCGGCGACCTGGAAAGCATCGACATCTCGAGATGTCGATGCTTTCCAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-307s1c1
Sequence:CCGGTCTCAGCCTCTTCTCGCAGATCTCGAGATCTGCGAGAAGAGGCTGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-1204s1c1
Sequence:CCGGCCTGCTCAACATGCGCTCCTTCTCGAGAAGGAGCGCATGTTGAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380171.1-1144s1c1
Sequence:CCGGCACCTGCCACATCGGCAAGTTCTCGAGAACTTGCCGATGTGGCAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)