EMAIL THIS PAGE TO A FRIEND

IRX2

iroquois homeobox 2

68 Gene Product Result for
Synonyms: IRXA2
UniProtKB ID: Q9BZI1, Q68A19, Q7Z2I7
Gene ID:
Human(153572) Summary: IRX2 is a member of the Iroquois homeobox gene family. Members of this family appear to play multiple roles during pattern formation of vertebrate embryos.[supplied by OMIM, Apr 2004]
Mouse(16372) Iroquois related homeobox 2 (Drosophila)
Rat(306657) iroquois homeobox 2
chicken(373975) iroquois homeobox 2
cow(100337321) iroquois homeobox 2
dog(488064) iroquois homeobox 2
domestic guinea pig(100714345) iroquois homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033267 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132281 MISSION® esiRNA esiRNA human IRX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033267 Rosetta Predictions human pricing
NM_001039505 Rosetta Predictions rat pricing
XM_001053004 Rosetta Predictions rat pricing
NM_010574 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084439 predicted 1576
2 SASI_Hs01_00084440 predicted 1661
3 SASI_Hs01_00084441 predicted 1539
4 SASI_Hs01_00084442 predicted 1658
5 SASI_Hs01_00084443 predicted 894
6 SASI_Hs01_00084444 predicted 816
7 SASI_Hs01_00084445 predicted 1662
8 SASI_Hs01_00084446 predicted 1677
9 SASI_Hs01_00084447 predicted 1585
10 SASI_Hs01_00084448 predicted 1721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106207 predicted 847
2 SASI_Rn02_00204843 predicted 1017
3 SASI_Rn01_00106208 predicted 1009
4 SASI_Rn01_00106210 predicted 1086
5 SASI_Rn01_00106211 predicted 920
6 SASI_Rn01_00106212 predicted 1012
7 SASI_Rn01_00106213 predicted 1448
8 SASI_Rn01_00106215 predicted 499
9 SASI_Rn02_00204844 predicted 915
10 SASI_Rn02_00204845 predicted 552
11 SASI_Rn01_00106209 predicted 1474
12 SASI_Rn01_00106214 predicted 752
13 SASI_Rn01_00106216 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271024 predicted 844
2 SASI_Rn02_00271025 predicted 1020
3 SASI_Rn02_00271026 predicted 1012
4 SASI_Rn02_00271027 predicted 1091
5 SASI_Rn02_00271028 predicted 917
6 SASI_Rn02_00271029 predicted 1011
7 SASI_Rn02_00271030 predicted 1445
8 SASI_Rn02_00271031 predicted 501
9 SASI_Rn02_00271032 predicted 909
10 SASI_Rn02_00271033 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010574 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030150 predicted 829
2 SASI_Mm01_00030151 predicted 659
3 SASI_Mm01_00030152 predicted 834
4 SASI_Mm01_00030153 predicted 734
5 SASI_Mm01_00030154 predicted 1264
6 SASI_Mm01_00030155 predicted 326
7 SASI_Mm01_00030156 predicted 729
8 SASI_Mm01_00030158 predicted 1327
9 SASI_Mm01_00030159 predicted 377
10 SASI_Mm02_00318848 predicted 399
11 SASI_Mm01_00030157 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010574
IRX2 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-598s1c1
Sequence:CCGGCGTCTCAAGAAGGAGAACAAACTCGAGTTTGTTCTCCTTCTTGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-847s1c1
Sequence:CCGGTCAGAGTGTAAGGACAAGTTTCTCGAGAAACTTGTCCTTACACTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-1257s1c1
Sequence:CCGGCTATGGCAACTACACAAACTACTCGAGTAGTTTGTGTAGTTGCCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-1446s1c1
Sequence:CCGGGCCCAAGAAAGATACCAGTGACTCGAGTCACTGGTATCTTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-348s1c1
Sequence:CCGGCGACACGCACACCACCGGAATCTCGAGATTCCGGTGGTGTGCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010574
IRX2 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-598s1c1
Sequence:CCGGCGTCTCAAGAAGGAGAACAAACTCGAGTTTGTTCTCCTTCTTGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-847s1c1
Sequence:CCGGTCAGAGTGTAAGGACAAGTTTCTCGAGAAACTTGTCCTTACACTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-1257s1c1
Sequence:CCGGCTATGGCAACTACACAAACTACTCGAGTAGTTTGTGTAGTTGCCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-1446s1c1
Sequence:CCGGGCCCAAGAAAGATACCAGTGACTCGAGTCACTGGTATCTTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-348s1c1
Sequence:CCGGCGACACGCACACCACCGGAATCTCGAGATTCCGGTGGTGTGCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010574
IRX2 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-598s1c1
Sequence:CCGGCGTCTCAAGAAGGAGAACAAACTCGAGTTTGTTCTCCTTCTTGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-847s1c1
Sequence:CCGGTCAGAGTGTAAGGACAAGTTTCTCGAGAAACTTGTCCTTACACTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-1257s1c1
Sequence:CCGGCTATGGCAACTACACAAACTACTCGAGTAGTTTGTGTAGTTGCCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-1446s1c1
Sequence:CCGGGCCCAAGAAAGATACCAGTGACTCGAGTCACTGGTATCTTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010574.2-348s1c1
Sequence:CCGGCGACACGCACACCACCGGAATCTCGAGATTCCGGTGGTGTGCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033267
IRX2 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1183s1c1
Sequence:CCGGCTACACAAACTACGGGAACTTCTCGAGAAGTTCCCGTAGTTTGTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1153s1c1
Sequence:CCGGCCTCTACTACACGTCGCCCTTCTCGAGAAGGGCGACGTGTAGTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-595s1c1
Sequence:CCGGCGCTACCAGAAGCAAGGACGACTCGAGTCGTCCTTGCTTCTGGTAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1174s1c1
Sequence:CCGGCTACGGCAACTACACAAACTACTCGAGTAGTTTGTGTAGTTGCCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-769s1c1
Sequence:CCGGCTCGGAGTGCAAGGACAAGTACTCGAGTACTTGTCCTTGCACTCCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033267
IRX2 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1183s1c1
Sequence:CCGGCTACACAAACTACGGGAACTTCTCGAGAAGTTCCCGTAGTTTGTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1153s1c1
Sequence:CCGGCCTCTACTACACGTCGCCCTTCTCGAGAAGGGCGACGTGTAGTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-595s1c1
Sequence:CCGGCGCTACCAGAAGCAAGGACGACTCGAGTCGTCCTTGCTTCTGGTAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1174s1c1
Sequence:CCGGCTACGGCAACTACACAAACTACTCGAGTAGTTTGTGTAGTTGCCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-769s1c1
Sequence:CCGGCTCGGAGTGCAAGGACAAGTACTCGAGTACTTGTCCTTGCACTCCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033267
IRX2 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1183s1c1
Sequence:CCGGCTACACAAACTACGGGAACTTCTCGAGAAGTTCCCGTAGTTTGTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1153s1c1
Sequence:CCGGCCTCTACTACACGTCGCCCTTCTCGAGAAGGGCGACGTGTAGTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-595s1c1
Sequence:CCGGCGCTACCAGAAGCAAGGACGACTCGAGTCGTCCTTGCTTCTGGTAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-1174s1c1
Sequence:CCGGCTACGGCAACTACACAAACTACTCGAGTAGTTTGTGTAGTTGCCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033267.1-769s1c1
Sequence:CCGGCTCGGAGTGCAAGGACAAGTACTCGAGTACTTGTCCTTGCACTCCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)