EMAIL THIS PAGE TO A FRIEND

IRX3

iroquois homeobox 3

59 Gene Product Result for
Synonyms: IRX-1 IRXB1
UniProtKB ID: P78415, Q7Z4A4, Q7Z4A5, Q8IVC6
Gene ID:
Human(79191) Summary: IRX3 is a member of the Iroquois homeobox gene family (see IRX1; MIM 606197) and plays a role in an early step of neural development (Bellefroid et al., 1998 [PubMed 9427753]
Mouse(16373) Iroquois related homeobox 3 (Drosophila)
Rat(307721) iroquois homeobox 3
Thale Cress(831608) cellulose synthase A catalytic subunit 7 [UDP-forming]
cow(540417) iroquois homeobox 3
dog(487277) iroquois homeobox 3
chicken(408181) iroquois homeobox 3
domestic guinea pig(100731142) iroquois homeobox 3
naked mole-rat(101698469) iroquois homeobox 3
sheep(101118126) iroquois homeobox 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108381 MISSION® esiRNA targeting human IRX3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024336 Rosetta Predictions human pricing
NM_001107413 Rosetta Predictions rat pricing
NM_008393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068579 predicted 2177
2 SASI_Hs01_00068580 predicted 1300
3 SASI_Hs01_00068581 predicted 2115
4 SASI_Hs01_00068582 predicted 2228
5 SASI_Hs01_00068583 predicted 2217
6 SASI_Hs01_00068584 predicted 2233
7 SASI_Hs01_00068586 predicted 2133
8 SASI_Hs01_00068587 predicted 2134
9 SASI_Hs01_00068588 predicted 1323
10 SASI_Hs02_00356692 predicted 1324
11 SASI_Hs01_00068585 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228575 predicted 1245
2 SASI_Rn02_00228576 predicted 1153
3 SASI_Rn02_00228577 predicted 1256
4 SASI_Rn02_00228578 predicted 1154
5 SASI_Rn02_00228579 predicted 1237
6 SASI_Rn02_00228580 predicted 1162
7 SASI_Rn02_00228581 predicted 1056
8 SASI_Rn02_00228582 predicted 1271
9 SASI_Rn02_00228583 predicted 1052
10 SASI_Rn02_00228584 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052609 predicted 268
2 SASI_Mm01_00052610 predicted 406
3 SASI_Mm01_00052611 predicted 1436
4 SASI_Mm01_00052612 predicted 280
5 SASI_Mm01_00052613 predicted 364
6 SASI_Mm01_00052614 predicted 1365
7 SASI_Mm01_00052615 predicted 1339
8 SASI_Mm01_00052616 predicted 266
9 SASI_Mm01_00052617 predicted 1403
10 SASI_Mm01_00052618 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024336
IRX3 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1809s1c1
Sequence:CCGGAGTGCCTTGGAAGTGGAGAAACTCGAGTTTCTCCACTTCCAAGGCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1891s1c1
Sequence:CCGGCCCTGGTCTTATCGGCTCTCTCTCGAGAGAGAGCCGATAAGACCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1173s1c1
Sequence:CCGGGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-566s1c1
Sequence:CCGGCAACGTGCTCTCGTCCGTGTACTCGAGTACACGGACGAGAGCACGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024336.2-2010s21c1
Sequence:CCGGTTGTAAGCATGTCCGTGTATACTCGAGTATACACGGACATGCTTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-965s1c1
Sequence:CCGGGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024336.2-2137s21c1
Sequence:CCGGGTTTGTTTGTCCGGTTGATTTCTCGAGAAATCAACCGGACAAACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024336.2-1298s21c1
Sequence:CCGGAGATAGCTCTGAGGGCTTAGACTCGAGTCTAAGCCCTCAGAGCTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024336
IRX3 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1809s1c1
Sequence:CCGGAGTGCCTTGGAAGTGGAGAAACTCGAGTTTCTCCACTTCCAAGGCACTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1891s1c1
Sequence:CCGGCCCTGGTCTTATCGGCTCTCTCTCGAGAGAGAGCCGATAAGACCAGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1173s1c1
Sequence:CCGGGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-566s1c1
Sequence:CCGGCAACGTGCTCTCGTCCGTGTACTCGAGTACACGGACGAGAGCACGTTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000433930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024336.2-2010s21c1
Sequence:CCGGTTGTAAGCATGTCCGTGTATACTCGAGTATACACGGACATGCTTACAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000016900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-965s1c1
Sequence:CCGGGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000436197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024336.2-2137s21c1
Sequence:CCGGGTTTGTTTGTCCGGTTGATTTCTCGAGAAATCAACCGGACAAACAAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000417031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024336.2-1298s21c1
Sequence:CCGGAGATAGCTCTGAGGGCTTAGACTCGAGTCTAAGCCCTCAGAGCTATCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024336
IRX3 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1809s1c1
Sequence:CCGGAGTGCCTTGGAAGTGGAGAAACTCGAGTTTCTCCACTTCCAAGGCACTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1891s1c1
Sequence:CCGGCCCTGGTCTTATCGGCTCTCTCTCGAGAGAGAGCCGATAAGACCAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-1173s1c1
Sequence:CCGGGAGATCGATTTGGAGAACTTACTCGAGTAAGTTCTCCAAATCGATCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-566s1c1
Sequence:CCGGCAACGTGCTCTCGTCCGTGTACTCGAGTACACGGACGAGAGCACGTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024336.2-2010s21c1
Sequence:CCGGTTGTAAGCATGTCCGTGTATACTCGAGTATACACGGACATGCTTACAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024336.1-965s1c1
Sequence:CCGGGCGCCTCAAGAAGGAGAATAACTCGAGTTATTCTCCTTCTTGAGGCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024336.2-2137s21c1
Sequence:CCGGGTTTGTTTGTCCGGTTGATTTCTCGAGAAATCAACCGGACAAACAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024336.2-1298s21c1
Sequence:CCGGAGATAGCTCTGAGGGCTTAGACTCGAGTCTAAGCCCTCAGAGCTATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008393
VALIDATED
IRX3 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008393.2-1367s1c1
Sequence:CCGGCGCTTGGACCAACAGGCCTTTCTCGAGAAAGGCCTGTTGGTCCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-1525s1c1
Sequence:CCGGAGAGTGGAACAGATCGCTGTACTCGAGTACAGCGATCTGTTCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-1716s1c1
Sequence:CCGGCGCTCTGTATAGTGACGAGTTCTCGAGAACTCGTCACTATACAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008393.2-168s1c1
Sequence:CCGGCGCCCTCTCTACCCACCCGAACTCGAGTTCGGGTGGGTAGAGAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-283s1c1
Sequence:CCGGCCCTATCCAATGTGCTTTCATCTCGAGATGAAAGCACATTGGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008393.2-1746s21c1
Sequence:CCGGTCTGTGTATGATTACCTTAAACTCGAGTTTAAGGTAATCATACACAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008393.2-895s21c1
Sequence:CCGGATGAGGAGATCGATTTGGAAACTCGAGTTTCCAAATCGATCTCCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008393.2-1884s21c1
Sequence:CCGGGTTCCTTCGTTGTGTTGATTTCTCGAGAAATCAACACAACGAAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008393
VALIDATED
IRX3 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008393.2-1367s1c1
Sequence:CCGGCGCTTGGACCAACAGGCCTTTCTCGAGAAAGGCCTGTTGGTCCAAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000096101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-1525s1c1
Sequence:CCGGAGAGTGGAACAGATCGCTGTACTCGAGTACAGCGATCTGTTCCACTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000096099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-1716s1c1
Sequence:CCGGCGCTCTGTATAGTGACGAGTTCTCGAGAACTCGTCACTATACAGAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000096103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008393.2-168s1c1
Sequence:CCGGCGCCCTCTCTACCCACCCGAACTCGAGTTCGGGTGGGTAGAGAGGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000096100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-283s1c1
Sequence:CCGGCCCTATCCAATGTGCTTTCATCTCGAGATGAAAGCACATTGGATAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008393.2-1746s21c1
Sequence:CCGGTCTGTGTATGATTACCTTAAACTCGAGTTTAAGGTAATCATACACAGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000417930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008393.2-895s21c1
Sequence:CCGGATGAGGAGATCGATTTGGAAACTCGAGTTTCCAAATCGATCTCCTCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000435053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008393.2-1884s21c1
Sequence:CCGGGTTCCTTCGTTGTGTTGATTTCTCGAGAAATCAACACAACGAAGGAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008393
VALIDATED
IRX3 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008393.2-1367s1c1
Sequence:CCGGCGCTTGGACCAACAGGCCTTTCTCGAGAAAGGCCTGTTGGTCCAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-1525s1c1
Sequence:CCGGAGAGTGGAACAGATCGCTGTACTCGAGTACAGCGATCTGTTCCACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-1716s1c1
Sequence:CCGGCGCTCTGTATAGTGACGAGTTCTCGAGAACTCGTCACTATACAGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008393.2-168s1c1
Sequence:CCGGCGCCCTCTCTACCCACCCGAACTCGAGTTCGGGTGGGTAGAGAGGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008393.2-283s1c1
Sequence:CCGGCCCTATCCAATGTGCTTTCATCTCGAGATGAAAGCACATTGGATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008393.2-1746s21c1
Sequence:CCGGTCTGTGTATGATTACCTTAAACTCGAGTTTAAGGTAATCATACACAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008393.2-895s21c1
Sequence:CCGGATGAGGAGATCGATTTGGAAACTCGAGTTTCCAAATCGATCTCCTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008393.2-1884s21c1
Sequence:CCGGGTTCCTTCGTTGTGTTGATTTCTCGAGAAATCAACACAACGAAGGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)