EMAIL THIS PAGE TO A FRIEND

IRX4

iroquois homeobox 4

64 Gene Product Result for
Synonyms: IRXA3
UniProtKB ID: P78413, B2RMW5, D3DTC5, Q2NL64, Q9UHR2
Gene ID:
Mouse(50916) Iroquois related homeobox 4 (Drosophila)
Rat(306655) iroquois homeobox 4
chicken(373974) iroquois homeobox 4
dog(478628) iroquois homeobox 4
domestic cat(101100870) iroquois homeobox 4
Horse(100147154) iroquois homeobox 4
cow(614900) iroquois homeobox 4
sheep(101111127) iroquois homeobox 4
domestic guinea pig(100731615) iroquois homeobox 4
naked mole-rat(101710905) iroquois homeobox 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32066 Anti-IRX4 antibody produced in rabbit IgG fraction of antiserum pig, bovine, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016358 Rosetta Predictions human pricing
NM_001107330 Rosetta Predictions rat pricing
NM_018885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097126 predicted 395
2 SASI_Hs01_00097127 predicted 409
3 SASI_Hs01_00097128 predicted 351
4 SASI_Hs01_00097129 predicted 1947
5 SASI_Hs01_00097130 predicted 1654
6 SASI_Hs01_00097131 predicted 1931
7 SASI_Hs01_00097132 predicted 395
8 SASI_Hs01_00097134 predicted 1951
9 SASI_Hs01_00097135 predicted 338
10 SASI_Hs02_00349333 predicted 1908
11 SASI_Hs01_00097133 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227775 predicted 2077
2 SASI_Rn02_00227776 predicted 1733
3 SASI_Rn02_00227777 predicted 808
4 SASI_Rn02_00227778 predicted 703
5 SASI_Rn02_00227779 predicted 1086
6 SASI_Rn02_00227780 predicted 721
7 SASI_Rn02_00227781 predicted 1302
8 SASI_Rn02_00227782 predicted 701
9 SASI_Rn02_00227783 predicted 1293
10 SASI_Rn02_00227784 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324300 predicted 440
2 SASI_Mm01_00039705 predicted 1836
3 SASI_Mm01_00039706 predicted 1884
4 SASI_Mm01_00039707 predicted 1694
5 SASI_Mm01_00039708 predicted 1828
6 SASI_Mm01_00039709 predicted 1273
7 SASI_Mm01_00039710 predicted 233
8 SASI_Mm02_00324301 predicted 1323
9 SASI_Mm01_00039711 predicted 1140
10 SASI_Mm01_00039712 predicted 1340
11 SASI_Mm01_00039713 predicted 477
12 SASI_Mm01_00039714 predicted 1531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016358
IRX4 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016358.2-752s21c1
Sequence:CCGGGAACAAGTGCGCAGACGAGAACTCGAGTTCTCGTCTGCGCACTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016358.2-2059s21c1
Sequence:CCGGATTTCATCCTCAGCACGTAATCTCGAGATTACGTGCTGAGGATGAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-887s1c1
Sequence:CCGGGCTTAGTGACTTGGACGACTTCTCGAGAAGTCGTCCAAGTCACTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-254s1c1
Sequence:CCGGGCCGGTCTACTGCCCGGTCTACTCGAGTAGACCGGGCAGTAGACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016358.2-356s21c1
Sequence:CCGGATCGCAGGGCTATGGCAACTACTCGAGTAGTTGCCATAGCCCTGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-421s1c1
Sequence:CCGGGCTTTGATTCCAAGGATGGTTCTCGAGAACCATCCTTGGAATCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-413s1c1
Sequence:CCGGGCTGAACAGCTTTGATTCCAACTCGAGTTGGAATCAAAGCTGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-1409s1c1
Sequence:CCGGCCCGGTAACCAGTCTCAGAAACTCGAGTTTCTGAGACTGGTTACCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016358
IRX4 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016358.2-752s21c1
Sequence:CCGGGAACAAGTGCGCAGACGAGAACTCGAGTTCTCGTCTGCGCACTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016358.2-2059s21c1
Sequence:CCGGATTTCATCCTCAGCACGTAATCTCGAGATTACGTGCTGAGGATGAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-887s1c1
Sequence:CCGGGCTTAGTGACTTGGACGACTTCTCGAGAAGTCGTCCAAGTCACTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-254s1c1
Sequence:CCGGGCCGGTCTACTGCCCGGTCTACTCGAGTAGACCGGGCAGTAGACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016358.2-356s21c1
Sequence:CCGGATCGCAGGGCTATGGCAACTACTCGAGTAGTTGCCATAGCCCTGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-421s1c1
Sequence:CCGGGCTTTGATTCCAAGGATGGTTCTCGAGAACCATCCTTGGAATCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-413s1c1
Sequence:CCGGGCTGAACAGCTTTGATTCCAACTCGAGTTGGAATCAAAGCTGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-1409s1c1
Sequence:CCGGCCCGGTAACCAGTCTCAGAAACTCGAGTTTCTGAGACTGGTTACCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016358
IRX4 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016358.2-752s21c1
Sequence:CCGGGAACAAGTGCGCAGACGAGAACTCGAGTTCTCGTCTGCGCACTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016358.2-2059s21c1
Sequence:CCGGATTTCATCCTCAGCACGTAATCTCGAGATTACGTGCTGAGGATGAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-887s1c1
Sequence:CCGGGCTTAGTGACTTGGACGACTTCTCGAGAAGTCGTCCAAGTCACTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-254s1c1
Sequence:CCGGGCCGGTCTACTGCCCGGTCTACTCGAGTAGACCGGGCAGTAGACCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016358.2-356s21c1
Sequence:CCGGATCGCAGGGCTATGGCAACTACTCGAGTAGTTGCCATAGCCCTGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-421s1c1
Sequence:CCGGGCTTTGATTCCAAGGATGGTTCTCGAGAACCATCCTTGGAATCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-413s1c1
Sequence:CCGGGCTGAACAGCTTTGATTCCAACTCGAGTTGGAATCAAAGCTGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016358.1-1409s1c1
Sequence:CCGGCCCGGTAACCAGTCTCAGAAACTCGAGTTTCTGAGACTGGTTACCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018885
IRX4 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-1450s1c1
Sequence:CCGGCCCAGTAACTAGCCTCAGAAACTCGAGTTTCTGAGGCTAGTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-800s1c1
Sequence:CCGGCCACCTAGAAATAAATGTGCACTCGAGTGCACATTTATTTCTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-1359s1c1
Sequence:CCGGGCCAAGGTCCAACGGGTGTATCTCGAGATACACCCGTTGGACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-307s1c1
Sequence:CCGGGCCCGTCTACTGCCCTGTCTACTCGAGTAGACAGGGCAGTAGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-565s1c1
Sequence:CCGGCCAGTACCCATATGACAGGTACTCGAGTACCTGTCATATGGGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018885
IRX4 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-1450s1c1
Sequence:CCGGCCCAGTAACTAGCCTCAGAAACTCGAGTTTCTGAGGCTAGTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-800s1c1
Sequence:CCGGCCACCTAGAAATAAATGTGCACTCGAGTGCACATTTATTTCTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-1359s1c1
Sequence:CCGGGCCAAGGTCCAACGGGTGTATCTCGAGATACACCCGTTGGACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-307s1c1
Sequence:CCGGGCCCGTCTACTGCCCTGTCTACTCGAGTAGACAGGGCAGTAGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-565s1c1
Sequence:CCGGCCAGTACCCATATGACAGGTACTCGAGTACCTGTCATATGGGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018885
IRX4 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-1450s1c1
Sequence:CCGGCCCAGTAACTAGCCTCAGAAACTCGAGTTTCTGAGGCTAGTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-800s1c1
Sequence:CCGGCCACCTAGAAATAAATGTGCACTCGAGTGCACATTTATTTCTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-1359s1c1
Sequence:CCGGGCCAAGGTCCAACGGGTGTATCTCGAGATACACCCGTTGGACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-307s1c1
Sequence:CCGGGCCCGTCTACTGCCCTGTCTACTCGAGTAGACAGGGCAGTAGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018885.1-565s1c1
Sequence:CCGGCCAGTACCCATATGACAGGTACTCGAGTACCTGTCATATGGGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)