EMAIL THIS PAGE TO A FRIEND

IRX6

iroquois homeobox 6

51 Gene Product Result for
Synonyms: IRX-3 IRX7 IRXB3
UniProtKB ID: P78412, B2RN06, Q7Z2K0
Gene ID:
Mouse(64379) Iroquois related homeobox 6 (Drosophila)
Rat(307715) iroquois homeobox 6
Thale Cress(831417) COBRA-like protein 4
chicken(374184) iroquois homeobox 6
dog(487275) iroquois homeobox 6
Horse(100061198) iroquois homeobox 6
cow(613888) iroquois homeobox 6
domestic cat(101100352) iroquois homeobox 6
sheep(101118892) iroquois homeobox 6
domestic guinea pig(100723030) iroquois homeobox 6
naked mole-rat(101697350) iroquois homeobox 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022428 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022428 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022428 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024335 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129231 MISSION® esiRNA esiRNA human IRX6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024335 Rosetta Predictions human pricing
NM_001102413 Rosetta Predictions rat pricing
NM_022428 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356690 predicted 943
2 SASI_Hs01_00190587 predicted 881
3 SASI_Hs01_00190590 predicted 1766
4 SASI_Hs01_00190591 predicted 1718
5 SASI_Hs01_00190592 predicted 931
6 SASI_Hs02_00356691 predicted 1876
7 SASI_Hs01_00190593 predicted 1917
8 SASI_Hs01_00190594 predicted 786
9 SASI_Hs01_00190595 predicted 608
10 SASI_Hs01_00190596 predicted 593
11 SASI_Hs01_00190588 predicted 2012
12 SASI_Hs01_00190589 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211454 predicted 1782
2 SASI_Rn02_00211455 predicted 1029
3 SASI_Rn02_00211456 predicted 1174
4 SASI_Rn02_00211457 predicted 1032
5 SASI_Rn02_00211458 predicted 2114
6 SASI_Rn02_00211459 predicted 1124
7 SASI_Rn02_00211460 predicted 942
8 SASI_Rn02_00211461 predicted 1946
9 SASI_Rn02_00211462 predicted 2114
10 SASI_Rn02_00211463 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022428 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089871 predicted 1656
2 SASI_Mm01_00089872 predicted 1066
3 SASI_Mm01_00089873 predicted 1767
4 SASI_Mm01_00089874 predicted 758
5 SASI_Mm01_00089875 predicted 1635
6 SASI_Mm01_00089876 predicted 905
7 SASI_Mm01_00089878 predicted 2036
8 SASI_Mm01_00089879 predicted 927
9 SASI_Mm01_00089880 predicted 1929
10 SASI_Mm02_00326599 predicted 1963
11 SASI_Mm01_00089877 predicted 1878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022428
IRX6 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022428.2-1997s21c1
Sequence:CCGGTCCGGATCCACATTCATATTACTCGAGTAATATGAATGTGGATCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022428.2-2186s21c1
Sequence:CCGGGTGTGCTCACAGGATACTTTGCTCGAGCAAAGTATCCTGTGAGCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-138s1c1
Sequence:CCGGCTGCCTCTACTCTTTGCTGTACTCGAGTACAGCAAAGAGTAGAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-397s1c1
Sequence:CCGGGCAGTATCAATACGACAGGTACTCGAGTACCTGTCGTATTGATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-1115s1c1
Sequence:CCGGAGTCCAGAGTGCCACATGATTCTCGAGAATCATGTGGCACTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-308s1c1
Sequence:CCGGCCTCAGTATGAGTTCAAGGATCTCGAGATCCTTGAACTCATACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-701s1c1
Sequence:CCGGCTGAATGGTGACACCAAAGATCTCGAGATCTTTGGTGTCACCATTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022428
IRX6 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022428.2-1997s21c1
Sequence:CCGGTCCGGATCCACATTCATATTACTCGAGTAATATGAATGTGGATCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022428.2-2186s21c1
Sequence:CCGGGTGTGCTCACAGGATACTTTGCTCGAGCAAAGTATCCTGTGAGCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-138s1c1
Sequence:CCGGCTGCCTCTACTCTTTGCTGTACTCGAGTACAGCAAAGAGTAGAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-397s1c1
Sequence:CCGGGCAGTATCAATACGACAGGTACTCGAGTACCTGTCGTATTGATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-1115s1c1
Sequence:CCGGAGTCCAGAGTGCCACATGATTCTCGAGAATCATGTGGCACTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-308s1c1
Sequence:CCGGCCTCAGTATGAGTTCAAGGATCTCGAGATCCTTGAACTCATACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-701s1c1
Sequence:CCGGCTGAATGGTGACACCAAAGATCTCGAGATCTTTGGTGTCACCATTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022428
IRX6 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022428.2-1997s21c1
Sequence:CCGGTCCGGATCCACATTCATATTACTCGAGTAATATGAATGTGGATCCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022428.2-2186s21c1
Sequence:CCGGGTGTGCTCACAGGATACTTTGCTCGAGCAAAGTATCCTGTGAGCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-138s1c1
Sequence:CCGGCTGCCTCTACTCTTTGCTGTACTCGAGTACAGCAAAGAGTAGAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-397s1c1
Sequence:CCGGGCAGTATCAATACGACAGGTACTCGAGTACCTGTCGTATTGATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-1115s1c1
Sequence:CCGGAGTCCAGAGTGCCACATGATTCTCGAGAATCATGTGGCACTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-308s1c1
Sequence:CCGGCCTCAGTATGAGTTCAAGGATCTCGAGATCCTTGAACTCATACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022428.1-701s1c1
Sequence:CCGGCTGAATGGTGACACCAAAGATCTCGAGATCTTTGGTGTCACCATTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024335
IRX6 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024335.2-1558s21c1
Sequence:CCGGACTACCCATGCTTGGAGAAACCTCGAGGTTTCTCCAAGCATGGGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024335.2-1234s21c1
Sequence:CCGGGCCTAACTGCTGACACCAAAGCTCGAGCTTTGGTGTCAGCAGTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-598s1c1
Sequence:CCGGCCAGCACCACATGCTGCGAATCTCGAGATTCGCAGCATGTGGTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-929s1c1
Sequence:CCGGGCAGTACCAATATGAACGGTACTCGAGTACCGTTCATATTGGTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-1140s1c1
Sequence:CCGGCGCCTCAAGAAAGAGAACAAACTCGAGTTTGTTCTCTTTCTTGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-894s1c1
Sequence:CCGGCCAGGAGCCTATTATCCCTATCTCGAGATAGGGATAATAGGCTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024335
IRX6 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024335.2-1558s21c1
Sequence:CCGGACTACCCATGCTTGGAGAAACCTCGAGGTTTCTCCAAGCATGGGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024335.2-1234s21c1
Sequence:CCGGGCCTAACTGCTGACACCAAAGCTCGAGCTTTGGTGTCAGCAGTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-598s1c1
Sequence:CCGGCCAGCACCACATGCTGCGAATCTCGAGATTCGCAGCATGTGGTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-929s1c1
Sequence:CCGGGCAGTACCAATATGAACGGTACTCGAGTACCGTTCATATTGGTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-1140s1c1
Sequence:CCGGCGCCTCAAGAAAGAGAACAAACTCGAGTTTGTTCTCTTTCTTGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-894s1c1
Sequence:CCGGCCAGGAGCCTATTATCCCTATCTCGAGATAGGGATAATAGGCTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024335
IRX6 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024335.2-1558s21c1
Sequence:CCGGACTACCCATGCTTGGAGAAACCTCGAGGTTTCTCCAAGCATGGGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024335.2-1234s21c1
Sequence:CCGGGCCTAACTGCTGACACCAAAGCTCGAGCTTTGGTGTCAGCAGTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-598s1c1
Sequence:CCGGCCAGCACCACATGCTGCGAATCTCGAGATTCGCAGCATGTGGTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-929s1c1
Sequence:CCGGGCAGTACCAATATGAACGGTACTCGAGTACCGTTCATATTGGTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-1140s1c1
Sequence:CCGGCGCCTCAAGAAAGAGAACAAACTCGAGTTTGTTCTCTTTCTTGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024335.2-894s1c1
Sequence:CCGGCCAGGAGCCTATTATCCCTATCTCGAGATAGGGATAATAGGCTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)