EMAIL THIS PAGE TO A FRIEND

ISCA1

iron-sulfur cluster assembly 1

74 Gene Product Result for
Synonyms: HBLD2 ISA1 RP11-507D14.2 hIscA
UniProtKB ID: Q9BUE6, B3KP34, Q8ND75, Q9BZR2
Gene ID:
Human(81689) Summary: ISCA1 is a mitochondrial protein involved in the biogenesis and assembly of iron-sulfur clusters, which play a role in electron-transfer reactions (Cozar-Castellano et al., 2004 [PubMed 15262227]
Mouse(69046) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
Rat(290985) iron-sulfur cluster assembly 1
Zebrafish(573999) iron-sulfur cluster assembly 1
chicken(427463) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
cow(514652) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
domestic cat(101083806) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
dog(607596) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
sheep(101114490) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
domestic guinea pig(100722562) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
naked mole-rat(101697806) iron-sulfur cluster assembly 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030940 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030940 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030940 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030940 Rosetta Predictions human pricing
NM_181626 Rosetta Predictions rat pricing
NM_026921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030940 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358515 predicted 464
2 SASI_Hs02_00358516 predicted 442
3 SASI_Hs02_00358517 predicted 420
4 SASI_Hs02_00358518 predicted 424
5 SASI_Hs01_00012441 predicted 805
6 SASI_Hs01_00012442 predicted 812
7 SASI_Hs01_00012443 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058681 predicted 601
2 SASI_Rn01_00058683 predicted 804
3 SASI_Rn01_00058684 predicted 636
4 SASI_Rn02_00269756 predicted 603
5 SASI_Rn01_00058689 predicted 762
6 SASI_Rn02_00269757 predicted 755
7 SASI_Rn02_00269758 predicted 771
8 SASI_Rn02_00269759 predicted 771
9 SASI_Rn02_00269760 predicted 762
10 SASI_Rn02_00269761 predicted 641
11 SASI_Rn01_00058680 predicted 332
12 SASI_Rn01_00058682 predicted 274
13 SASI_Rn01_00058685 predicted 310
14 SASI_Rn01_00058686 predicted 235
15 SASI_Rn01_00058687 predicted 365
16 SASI_Rn01_00058688 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021532 predicted 820
2 SASI_Mm01_00021533 predicted 737
3 SASI_Mm01_00021534 predicted 899
4 SASI_Mm01_00021535 predicted 760
5 SASI_Mm01_00021536 predicted 296
6 SASI_Mm01_00021537 predicted 863
7 SASI_Mm01_00021538 predicted 453
8 SASI_Mm01_00021540 predicted 605
9 SASI_Mm01_00021541 predicted 834
10 SASI_Mm02_00331199 predicted 805
11 SASI_Mm01_00021539 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026921
ISCA1 MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026921.2-891s1c1
Sequence:CCGGGCATGGCTTGAGTGTGTCTATCTCGAGATAGACACACTCAAGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026921.2-380s1c1
Sequence:CCGGGATGGACTATGTGGAAGACAACTCGAGTTGTCTTCCACATAGTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026921.2-298s1c1
Sequence:CCGGGAGATTCTGATGAAGAAGTTACTCGAGTAACTTCTTCATCAGAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026921.2-912s1c1
Sequence:CCGGCCCTTTCTCAATCTTTGCCAACTCGAGTTGGCAAAGATTGAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026921.4-172s21c1
Sequence:CCGGCTCTGCTGTAAACAAGATAAACTCGAGTTTATCTTGTTTACAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026921
ISCA1 MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026921.2-891s1c1
Sequence:CCGGGCATGGCTTGAGTGTGTCTATCTCGAGATAGACACACTCAAGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026921.2-380s1c1
Sequence:CCGGGATGGACTATGTGGAAGACAACTCGAGTTGTCTTCCACATAGTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026921.2-298s1c1
Sequence:CCGGGAGATTCTGATGAAGAAGTTACTCGAGTAACTTCTTCATCAGAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026921.2-912s1c1
Sequence:CCGGCCCTTTCTCAATCTTTGCCAACTCGAGTTGGCAAAGATTGAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026921.4-172s21c1
Sequence:CCGGCTCTGCTGTAAACAAGATAAACTCGAGTTTATCTTGTTTACAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026921
ISCA1 MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026921.2-891s1c1
Sequence:CCGGGCATGGCTTGAGTGTGTCTATCTCGAGATAGACACACTCAAGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026921.2-380s1c1
Sequence:CCGGGATGGACTATGTGGAAGACAACTCGAGTTGTCTTCCACATAGTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026921.2-298s1c1
Sequence:CCGGGAGATTCTGATGAAGAAGTTACTCGAGTAACTTCTTCATCAGAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026921.2-912s1c1
Sequence:CCGGCCCTTTCTCAATCTTTGCCAACTCGAGTTGGCAAAGATTGAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026921.4-172s21c1
Sequence:CCGGCTCTGCTGTAAACAAGATAAACTCGAGTTTATCTTGTTTACAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030940
VALIDATED
ISCA1 MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-150s1c1
Sequence:CCGGCCTGACACCTTCAGCAGTAAACTCGAGTTTACTGCTGAAGGTGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-301s1c1
Sequence:CCGGGTTATTCAAGATGGAGTCAGACTCGAGTCTGACTCCATCTTGAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-239s1c1
Sequence:CCGGGCTGTAATGGCCTTTCTTATACTCGAGTATAAGAAAGGCCATTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-437s1c1
Sequence:CCGGGCTGTGGAGAAAGCTTTAATACTCGAGTATTAAAGCTTTCTCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-187s1c1
Sequence:CCGGCTTAAAGATAAGCCTGAGCATCTCGAGATGCTCAGGCTTATCTTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-157s1c1
Sequence:CCGGCCTTCAGCAGTAAACAAGATACTCGAGTATCTTGTTTACTGCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-415s1c1
Sequence:CCGGCCAAACATCAAAGGGACTTGTCTCGAGACAAGTCCCTTTGATGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030940.2-193s1c1
Sequence:CCGGGATAAGCCTGAGCATGTAGGTCTCGAGACCTACATGCTCAGGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-414s1c1
Sequence:CCGGCCCAAACATCAAAGGGACTTGCTCGAGCAAGTCCCTTTGATGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-886s21c1
Sequence:CCGGATCGTGACTGCTGGTAGTAATCTCGAGATTACTACCAGCAGTCACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-474s21c1
Sequence:CCGGGACTTGTGGCTGTGGAGAAAGCTCGAGCTTTCTCCACAGCCACAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-415s21c1
Sequence:CCGGGACTATGTTGAAGACAAATTACTCGAGTAATTTGTCTTCAACATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-438s21c1
Sequence:CCGGCAGTGAGTTTGTGTTCAATAACTCGAGTTATTGAACACAAACTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-243s21c1
Sequence:CCGGGCCTGAGCATGTAGGTGTAAACTCGAGTTTACACCTACATGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030940
VALIDATED
ISCA1 MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-150s1c1
Sequence:CCGGCCTGACACCTTCAGCAGTAAACTCGAGTTTACTGCTGAAGGTGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-301s1c1
Sequence:CCGGGTTATTCAAGATGGAGTCAGACTCGAGTCTGACTCCATCTTGAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-239s1c1
Sequence:CCGGGCTGTAATGGCCTTTCTTATACTCGAGTATAAGAAAGGCCATTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-437s1c1
Sequence:CCGGGCTGTGGAGAAAGCTTTAATACTCGAGTATTAAAGCTTTCTCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-187s1c1
Sequence:CCGGCTTAAAGATAAGCCTGAGCATCTCGAGATGCTCAGGCTTATCTTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-157s1c1
Sequence:CCGGCCTTCAGCAGTAAACAAGATACTCGAGTATCTTGTTTACTGCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-415s1c1
Sequence:CCGGCCAAACATCAAAGGGACTTGTCTCGAGACAAGTCCCTTTGATGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030940.2-193s1c1
Sequence:CCGGGATAAGCCTGAGCATGTAGGTCTCGAGACCTACATGCTCAGGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-414s1c1
Sequence:CCGGCCCAAACATCAAAGGGACTTGCTCGAGCAAGTCCCTTTGATGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-886s21c1
Sequence:CCGGATCGTGACTGCTGGTAGTAATCTCGAGATTACTACCAGCAGTCACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-474s21c1
Sequence:CCGGGACTTGTGGCTGTGGAGAAAGCTCGAGCTTTCTCCACAGCCACAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-415s21c1
Sequence:CCGGGACTATGTTGAAGACAAATTACTCGAGTAATTTGTCTTCAACATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-438s21c1
Sequence:CCGGCAGTGAGTTTGTGTTCAATAACTCGAGTTATTGAACACAAACTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-243s21c1
Sequence:CCGGGCCTGAGCATGTAGGTGTAAACTCGAGTTTACACCTACATGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030940
VALIDATED
ISCA1 MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-150s1c1
Sequence:CCGGCCTGACACCTTCAGCAGTAAACTCGAGTTTACTGCTGAAGGTGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-301s1c1
Sequence:CCGGGTTATTCAAGATGGAGTCAGACTCGAGTCTGACTCCATCTTGAATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-239s1c1
Sequence:CCGGGCTGTAATGGCCTTTCTTATACTCGAGTATAAGAAAGGCCATTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-437s1c1
Sequence:CCGGGCTGTGGAGAAAGCTTTAATACTCGAGTATTAAAGCTTTCTCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-187s1c1
Sequence:CCGGCTTAAAGATAAGCCTGAGCATCTCGAGATGCTCAGGCTTATCTTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-157s1c1
Sequence:CCGGCCTTCAGCAGTAAACAAGATACTCGAGTATCTTGTTTACTGCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030940.2-415s1c1
Sequence:CCGGCCAAACATCAAAGGGACTTGTCTCGAGACAAGTCCCTTTGATGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030940.2-193s1c1
Sequence:CCGGGATAAGCCTGAGCATGTAGGTCTCGAGACCTACATGCTCAGGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030940.2-414s1c1
Sequence:CCGGCCCAAACATCAAAGGGACTTGCTCGAGCAAGTCCCTTTGATGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-886s21c1
Sequence:CCGGATCGTGACTGCTGGTAGTAATCTCGAGATTACTACCAGCAGTCACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-474s21c1
Sequence:CCGGGACTTGTGGCTGTGGAGAAAGCTCGAGCTTTCTCCACAGCCACAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-415s21c1
Sequence:CCGGGACTATGTTGAAGACAAATTACTCGAGTAATTTGTCTTCAACATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-438s21c1
Sequence:CCGGCAGTGAGTTTGTGTTCAATAACTCGAGTTATTGAACACAAACTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030940.3-243s21c1
Sequence:CCGGGCCTGAGCATGTAGGTGTAAACTCGAGTTTACACCTACATGCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)