EMAIL THIS PAGE TO A FRIEND

ISCA1P1

iron-sulfur cluster assembly 1 pseudogene 1

13 Gene Product Result for
Synonyms: ISCA1L
Species: Human ISCA1P1(389293)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080540 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080540 Rosetta Predictions human pricing
XM_371741 Rosetta Predictions human pricing
XM_931683 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315821 predicted 507
2 SASI_Hs02_00315822 predicted 513
3 SASI_Hs02_00315823 predicted 670
4 SASI_Hs02_00315824 predicted 634
5 SASI_Hs02_00315825 predicted 385
6 SASI_Hs02_00315826 predicted 853
7 SASI_Hs02_00315827 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287865 predicted 964
2 SASI_Hs01_00287866 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247795 predicted 852
2 SASI_Hs01_00247796 predicted 845
3 SASI_Hs01_00247797 predicted 510
4 SASI_Hs01_00247798 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080540
ISCA1P1 MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly 1 pseudogene 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-294s21c1
Sequence:CCGGGATTCTGATGAAGAAGTTATTCTCGAGAATAACTTCTTCATCAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-853s21c1
Sequence:CCGGTGCCTCATTGTATACCCTTTACTCGAGTAAAGGGTATACAATGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-1598s21c1
Sequence:CCGGTTTCCTGGGTTTGACATATTACTCGAGTAATATGTCAAACCCAGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-399s21c1
Sequence:CCGGTCCAGTTCCAGGAAAGCTCGTCTCGAGACGAGCTTTCCTGGAACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-1345s21c1
Sequence:CCGGGAATTACCTCTTGTTTCTTTCCTCGAGGAAAGAAACAAGAGGTAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-364s21c1
Sequence:CCGGTAGGAACAGAAATGGACTATGCTCGAGCATAGTCCATTTCTGTTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-387s21c1
Sequence:CCGGGAAGACAAATTATCCAGTTCCCTCGAGGGAACTGGATAATTTGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080540
ISCA1P1 MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly 1 pseudogene 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-294s21c1
Sequence:CCGGGATTCTGATGAAGAAGTTATTCTCGAGAATAACTTCTTCATCAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-853s21c1
Sequence:CCGGTGCCTCATTGTATACCCTTTACTCGAGTAAAGGGTATACAATGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-1598s21c1
Sequence:CCGGTTTCCTGGGTTTGACATATTACTCGAGTAATATGTCAAACCCAGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-399s21c1
Sequence:CCGGTCCAGTTCCAGGAAAGCTCGTCTCGAGACGAGCTTTCCTGGAACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-1345s21c1
Sequence:CCGGGAATTACCTCTTGTTTCTTTCCTCGAGGAAAGAAACAAGAGGTAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-364s21c1
Sequence:CCGGTAGGAACAGAAATGGACTATGCTCGAGCATAGTCCATTTCTGTTCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-387s21c1
Sequence:CCGGGAAGACAAATTATCCAGTTCCCTCGAGGGAACTGGATAATTTGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080540
ISCA1P1 MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly 1 pseudogene 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-294s21c1
Sequence:CCGGGATTCTGATGAAGAAGTTATTCTCGAGAATAACTTCTTCATCAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-853s21c1
Sequence:CCGGTGCCTCATTGTATACCCTTTACTCGAGTAAAGGGTATACAATGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-1598s21c1
Sequence:CCGGTTTCCTGGGTTTGACATATTACTCGAGTAATATGTCAAACCCAGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-399s21c1
Sequence:CCGGTCCAGTTCCAGGAAAGCTCGTCTCGAGACGAGCTTTCCTGGAACTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080540.1-1345s21c1
Sequence:CCGGGAATTACCTCTTGTTTCTTTCCTCGAGGAAAGAAACAAGAGGTAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-364s21c1
Sequence:CCGGTAGGAACAGAAATGGACTATGCTCGAGCATAGTCCATTTCTGTTCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080540.1-387s21c1
Sequence:CCGGGAAGACAAATTATCCAGTTCCCTCGAGGGAACTGGATAATTTGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)