EMAIL THIS PAGE TO A FRIEND

ISCA2

iron-sulfur cluster assembly 2

134 Gene Product Result for
Synonyms: HBLD1 ISA2 c14_5557
UniProtKB ID: Q86U28, A6NFF1, A8K3W3, Q8IYZ0, Q96BB2
Gene ID:
Human(122961) Summary: The protein encoded by this gene is an A-type iron-sulfur cluster (ISC) protein found in mitochondria. The encoded protein appears to be involved in the maturation of mitochondrial iron-sulfur proteins. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(74316) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
Rat(500694) iron-sulfur cluster assembly 2
chicken(423352) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
cow(613290) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
domestic cat(101094513) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
dog(490783) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
domestic guinea pig(100733611) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
naked mole-rat(101700464) iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_194279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194279 Rosetta Predictions human pricing
NM_001109278 Rosetta Predictions rat pricing
XM_203592 Rosetta Predictions mouse pricing
XM_900462 Rosetta Predictions mouse pricing
XM_900471 Rosetta Predictions mouse pricing
XM_900484 Rosetta Predictions mouse pricing
XM_908230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062637 predicted 707
2 SASI_Hs01_00062638 predicted 461
3 SASI_Hs02_00371391 predicted 813
4 SASI_Hs02_00371392 predicted 777
5 SASI_Hs02_00371393 predicted 537
6 SASI_Hs01_00062639 predicted 511
7 SASI_Hs01_00062640 predicted 725
8 SASI_Hs01_00062641 predicted 332
9 SASI_Hs01_00062644 predicted 548
10 SASI_Hs02_00371394 predicted 798
11 SASI_Hs01_00062635 predicted 521
12 SASI_Hs01_00062636 predicted 595
13 SASI_Hs01_00062642 predicted 561
14 SASI_Hs01_00062643 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246844 predicted 564
2 SASI_Rn02_00246845 predicted 488
3 SASI_Rn02_00246846 predicted 362
4 SASI_Rn02_00246847 predicted 546
5 SASI_Rn02_00246848 predicted 442
6 SASI_Rn02_00246849 predicted 294
7 SASI_Rn02_00246850 predicted 582
8 SASI_Rn02_00246851 predicted 377
9 SASI_Rn02_00246852 predicted 383
10 SASI_Rn02_00246853 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218784 predicted 516
2 SASI_Mm01_00218785 predicted 617
3 SASI_Mm01_00218786 predicted 528
4 SASI_Mm01_00218787 predicted 541
5 SASI_Mm01_00218788 predicted 542
6 SASI_Mm01_00218789 predicted 545
7 SASI_Mm01_00218790 predicted 549
8 SASI_Mm01_00218791 predicted 554
9 SASI_Mm01_00218792 predicted 528
10 SASI_Mm02_00425525 predicted 632
11 SASI_Mm01_00218783 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207020 predicted 435
2 SASI_Mm01_00207021 predicted 444
3 SASI_Mm01_00207022 predicted 454
4 SASI_Mm01_00207023 predicted 534
5 SASI_Mm01_00207024 predicted 498
6 SASI_Mm01_00207025 predicted 600
7 SASI_Mm01_00207026 predicted 586
8 SASI_Mm01_00207027 predicted 369
9 SASI_Mm01_00207028 predicted 316
10 SASI_Mm01_00207029 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214951 predicted 457
2 SASI_Mm01_00214952 predicted 389
3 SASI_Mm01_00214953 predicted 475
4 SASI_Mm01_00214954 predicted 396
5 SASI_Mm01_00214955 predicted 409
6 SASI_Mm01_00214956 predicted 400
7 SASI_Mm01_00214957 predicted 411
8 SASI_Mm01_00214958 predicted 424
9 SASI_Mm01_00214959 predicted 417
10 SASI_Mm01_00214960 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280594 predicted 467
2 SASI_Mm01_00280595 predicted 400
3 SASI_Mm01_00280596 predicted 498
4 SASI_Mm01_00280597 predicted 410
5 SASI_Mm01_00280598 predicted 420
6 SASI_Mm01_00280599 predicted 424
7 SASI_Mm01_00280600 predicted 426
8 SASI_Mm01_00280601 predicted 441
9 SASI_Mm01_00280602 predicted 428
10 SASI_Mm01_00280603 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433878 predicted 254
2 SASI_Mm02_00433879 predicted 468
3 SASI_Mm02_00433880 predicted 532
4 SASI_Mm02_00433881 predicted 543
5 SASI_Mm02_00433882 predicted 332
6 SASI_Mm02_00433883 predicted 354
7 SASI_Mm02_00433884 predicted 546
8 SASI_Mm02_00433885 predicted 549
9 SASI_Mm02_00433886 predicted 529
10 SASI_Mm02_00433887 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028863
VALIDATED
ISCA2 MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-269s21c1
Sequence:CCGGTCCGGATTCCAATACAAATTTCTCGAGAAATTTGTATTGGAATCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-420s21c1
Sequence:CCGGGCTCATTCCAAGTGTTGAATACTCGAGTATTCAACACTTGGAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-471s21c1
Sequence:CCGGGGTCATCCTTCTCTGTCAAAGCTCGAGCTTTGACAGAGAAGGATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-361s21c1
Sequence:CCGGTGATAGCTTGGCCTTCGTTAACTCGAGTTAACGAAGGCCAAGCTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-586s21c1
Sequence:CCGGGTCCGGCTCTCATCTTATTTACTCGAGTAAATAAGATGAGAGCCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028863
VALIDATED
ISCA2 MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-269s21c1
Sequence:CCGGTCCGGATTCCAATACAAATTTCTCGAGAAATTTGTATTGGAATCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-420s21c1
Sequence:CCGGGCTCATTCCAAGTGTTGAATACTCGAGTATTCAACACTTGGAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-471s21c1
Sequence:CCGGGGTCATCCTTCTCTGTCAAAGCTCGAGCTTTGACAGAGAAGGATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-361s21c1
Sequence:CCGGTGATAGCTTGGCCTTCGTTAACTCGAGTTAACGAAGGCCAAGCTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-586s21c1
Sequence:CCGGGTCCGGCTCTCATCTTATTTACTCGAGTAAATAAGATGAGAGCCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028863
VALIDATED
ISCA2 MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-269s21c1
Sequence:CCGGTCCGGATTCCAATACAAATTTCTCGAGAAATTTGTATTGGAATCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-420s21c1
Sequence:CCGGGCTCATTCCAAGTGTTGAATACTCGAGTATTCAACACTTGGAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-471s21c1
Sequence:CCGGGGTCATCCTTCTCTGTCAAAGCTCGAGCTTTGACAGAGAAGGATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-361s21c1
Sequence:CCGGTGATAGCTTGGCCTTCGTTAACTCGAGTTAACGAAGGCCAAGCTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028863.1-586s21c1
Sequence:CCGGGTCCGGCTCTCATCTTATTTACTCGAGTAAATAAGATGAGAGCCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194279
VALIDATED
ISCA2 MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194279.1-514s1c1
Sequence:CCGGCCAATTTGAAGAACGTGGAATCTCGAGATTCCACGTTCTTCAAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-407s1c1
Sequence:CCGGCAAGTGTTGAACAATCCTCAACTCGAGTTGAGGATTGTTCAACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-399s1c1
Sequence:CCGGGCTCATTTCAAGTGTTGAACACTCGAGTGTTCAACACTTGAAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-702s1c1
Sequence:CCGGCCTCAGATTTAATCACTGGTTCTCGAGAACCAGTGATTAAATCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-394s1c1
Sequence:CCGGCCGAAGCTCATTTCAAGTGTTCTCGAGAACACTTGAAATGAGCTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194279.1-689s1c1
Sequence:CCGGCCAGATGCTGTTACCTCAGATCTCGAGATCTGAGGTAACAGCATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-194s1c1
Sequence:CCGGGAAATCACCGAAGGGTCAGAACTCGAGTTCTGACCCTTCGGTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-324s1c1
Sequence:CCGGGAGTGGTGGTTGACTCTGATACTCGAGTATCAGAGTCAACCACCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-395s1c1
Sequence:CCGGCGAAGCTCATTTCAAGTGTTGCTCGAGCAACACTTGAAATGAGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-715s1c1
Sequence:CCGGCACTGGTTGAAACTCCGTATACTCGAGTATACGGAGTTTCAACCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194279
VALIDATED
ISCA2 MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194279.1-514s1c1
Sequence:CCGGCCAATTTGAAGAACGTGGAATCTCGAGATTCCACGTTCTTCAAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-407s1c1
Sequence:CCGGCAAGTGTTGAACAATCCTCAACTCGAGTTGAGGATTGTTCAACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-399s1c1
Sequence:CCGGGCTCATTTCAAGTGTTGAACACTCGAGTGTTCAACACTTGAAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-702s1c1
Sequence:CCGGCCTCAGATTTAATCACTGGTTCTCGAGAACCAGTGATTAAATCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-394s1c1
Sequence:CCGGCCGAAGCTCATTTCAAGTGTTCTCGAGAACACTTGAAATGAGCTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194279.1-689s1c1
Sequence:CCGGCCAGATGCTGTTACCTCAGATCTCGAGATCTGAGGTAACAGCATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-194s1c1
Sequence:CCGGGAAATCACCGAAGGGTCAGAACTCGAGTTCTGACCCTTCGGTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-324s1c1
Sequence:CCGGGAGTGGTGGTTGACTCTGATACTCGAGTATCAGAGTCAACCACCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-395s1c1
Sequence:CCGGCGAAGCTCATTTCAAGTGTTGCTCGAGCAACACTTGAAATGAGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-715s1c1
Sequence:CCGGCACTGGTTGAAACTCCGTATACTCGAGTATACGGAGTTTCAACCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194279
VALIDATED
ISCA2 MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145617    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194279.1-514s1c1
Sequence:CCGGCCAATTTGAAGAACGTGGAATCTCGAGATTCCACGTTCTTCAAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-407s1c1
Sequence:CCGGCAAGTGTTGAACAATCCTCAACTCGAGTTGAGGATTGTTCAACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-399s1c1
Sequence:CCGGGCTCATTTCAAGTGTTGAACACTCGAGTGTTCAACACTTGAAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-702s1c1
Sequence:CCGGCCTCAGATTTAATCACTGGTTCTCGAGAACCAGTGATTAAATCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-394s1c1
Sequence:CCGGCCGAAGCTCATTTCAAGTGTTCTCGAGAACACTTGAAATGAGCTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_194279.1-689s1c1
Sequence:CCGGCCAGATGCTGTTACCTCAGATCTCGAGATCTGAGGTAACAGCATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-194s1c1
Sequence:CCGGGAAATCACCGAAGGGTCAGAACTCGAGTTCTGACCCTTCGGTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-324s1c1
Sequence:CCGGGAGTGGTGGTTGACTCTGATACTCGAGTATCAGAGTCAACCACCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194279.1-395s1c1
Sequence:CCGGCGAAGCTCATTTCAAGTGTTGCTCGAGCAACACTTGAAATGAGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_194279.1-715s1c1
Sequence:CCGGCACTGGTTGAAACTCCGTATACTCGAGTATACGGAGTTTCAACCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)