EMAIL THIS PAGE TO A FRIEND

ISCU

iron-sulfur cluster assembly enzyme

77 Gene Product Result for
Synonyms: 2310020H20Rik HML ISU2 NIFU NIFUN hnifU
UniProtKB ID: Q9H1K1, Q6P713, Q99617, Q9H1K2
Gene ID:
Human(23479) Summary: Iron-sulfur (Fe-S) clusters are necessary for several mitochondrial enzymes and other subcellular compartment proteins. They contain sulfur and iron, and are created via several steps that include cysteine desulfurases, iron donors, chaperones, and scaffold proteins. This gene encodes the two isomeric forms, ISCU1 and ISCU2, of the Fe-S cluster scaffold protein. Mutations in this gene have been found in patients with myopathy with severe exercise intolerance and myoglobinuria. [provided by RefSeq, Jul 2008]
Mouse(66383) IscU iron-sulfur cluster scaffold homolog (E. coli)
Rat(288740) iron-sulfur cluster scaffold homolog (E. coli)
chicken(416891) iron-sulfur cluster scaffold homolog (E. coli)
cow(514789) iron-sulfur cluster scaffold homolog (E. coli)
domestic cat(101088192) iron-sulfur cluster scaffold homolog (E. coli)
dog(477527) iron-sulfur cluster scaffold homolog (E. coli)
domestic guinea pig(100724516) iron-sulfur cluster scaffold homolog (E. coli)
naked mole-rat(101713201) iron-sulfur cluster scaffold homolog (E. coli)
sheep(101103093) iron-sulfur cluster scaffold homolog (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014301 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178551 MISSION® esiRNA esiRNA targeting mouse Iscu mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014301 Rosetta Predictions human pricing
NM_213595 Rosetta Predictions human pricing
NM_001105936 Rosetta Predictions rat pricing
NM_025526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208970 predicted 454
2 SASI_Hs01_00208971 predicted 727
3 SASI_Hs01_00208972 predicted 510
4 SASI_Hs01_00208973 predicted 446
5 SASI_Hs01_00208974 predicted 766
6 SASI_Hs01_00208975 predicted 562
7 SASI_Hs01_00208976 predicted 713
8 SASI_Hs01_00208977 predicted 713
9 SASI_Hs01_00208978 predicted 704
10 SASI_Hs01_00208979 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127897 predicted 357
2 SASI_Hs01_00127898 predicted 630
3 SASI_Hs01_00127899 predicted 411
4 SASI_Hs01_00127900 predicted 359
5 SASI_Hs01_00127901 predicted 676
6 SASI_Hs01_00127902 predicted 461
7 SASI_Hs01_00127903 predicted 615
8 SASI_Hs01_00127904 predicted 612
9 SASI_Hs01_00127905 predicted 611
10 SASI_Hs01_00127906 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214002 predicted 622
2 SASI_Rn02_00214003 predicted 674
3 SASI_Rn02_00214004 predicted 628
4 SASI_Rn02_00214005 predicted 241
5 SASI_Rn02_00214006 predicted 241
6 SASI_Rn02_00214007 predicted 280
7 SASI_Rn02_00214008 predicted 243
8 SASI_Rn02_00214009 predicted 234
9 SASI_Rn02_00214010 predicted 589
10 SASI_Rn02_00214011 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328437 predicted 215
2 SASI_Mm02_00328438 predicted 565
3 SASI_Mm01_00118076 predicted 225
4 SASI_Mm01_00118077 predicted 621
5 SASI_Mm01_00118078 predicted 592
6 SASI_Mm01_00118079 predicted 654
7 SASI_Mm01_00118080 predicted 410
8 SASI_Mm01_00118081 predicted 261
9 SASI_Mm01_00118083 predicted 524
10 SASI_Mm01_00118084 predicted 308
11 SASI_Mm01_00118075 predicted 220
12 SASI_Mm01_00118082 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025526
VALIDATED
ISCU MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly enzyme
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025526.4-665s21c1
Sequence:CCGGCGTGTGTCCTTAGTGCAGTTACTCGAGTAACTGCACTAAGGACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025526.1-169s1c1
Sequence:CCGGGATCCCTTGACAAGACATCTACTCGAGTAGATGTCTTGTCAAGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-471s1c1
Sequence:CCGGGCTGACTACAAACTGAAGCAACTCGAGTTGCTTCAGTTTGTAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-467s1c1
Sequence:CCGGCCTGGCTGACTACAAACTGAACTCGAGTTCAGTTTGTAGTCAGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-233s1c1
Sequence:CCGGCGTCATGAAACTGCAGATCCACTCGAGTGGATCTGCAGTTTCATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-127s21c1
Sequence:CCGGCAAGAAGGTTGTGGATCATTACTCGAGTAATGATCCACAACCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-466s21c1
Sequence:CCGGCCTGGCTGACTACAAACTGAACTCGAGTTCAGTTTGTAGTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-665s1c1
Sequence:CCGGCGTGTGTCCTTAGTGCAGTTACTCGAGTAACTGCACTAAGGACACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-232s21c1
Sequence:CCGGCGTCATGAAACTGCAGATCCACTCGAGTGGATCTGCAGTTTCATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025526.1-126s1c1
Sequence:CCGGCACAAGAAGGTTGTGGATCATCTCGAGATGATCCACAACCTTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025526
VALIDATED
ISCU MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly enzyme
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025526.4-665s21c1
Sequence:CCGGCGTGTGTCCTTAGTGCAGTTACTCGAGTAACTGCACTAAGGACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025526.1-169s1c1
Sequence:CCGGGATCCCTTGACAAGACATCTACTCGAGTAGATGTCTTGTCAAGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-471s1c1
Sequence:CCGGGCTGACTACAAACTGAAGCAACTCGAGTTGCTTCAGTTTGTAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-467s1c1
Sequence:CCGGCCTGGCTGACTACAAACTGAACTCGAGTTCAGTTTGTAGTCAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-233s1c1
Sequence:CCGGCGTCATGAAACTGCAGATCCACTCGAGTGGATCTGCAGTTTCATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-127s21c1
Sequence:CCGGCAAGAAGGTTGTGGATCATTACTCGAGTAATGATCCACAACCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-466s21c1
Sequence:CCGGCCTGGCTGACTACAAACTGAACTCGAGTTCAGTTTGTAGTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-665s1c1
Sequence:CCGGCGTGTGTCCTTAGTGCAGTTACTCGAGTAACTGCACTAAGGACACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-232s21c1
Sequence:CCGGCGTCATGAAACTGCAGATCCACTCGAGTGGATCTGCAGTTTCATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025526.1-126s1c1
Sequence:CCGGCACAAGAAGGTTGTGGATCATCTCGAGATGATCCACAACCTTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025526
VALIDATED
ISCU MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly enzyme
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025526.4-665s21c1
Sequence:CCGGCGTGTGTCCTTAGTGCAGTTACTCGAGTAACTGCACTAAGGACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025526.1-169s1c1
Sequence:CCGGGATCCCTTGACAAGACATCTACTCGAGTAGATGTCTTGTCAAGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-471s1c1
Sequence:CCGGGCTGACTACAAACTGAAGCAACTCGAGTTGCTTCAGTTTGTAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-467s1c1
Sequence:CCGGCCTGGCTGACTACAAACTGAACTCGAGTTCAGTTTGTAGTCAGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-233s1c1
Sequence:CCGGCGTCATGAAACTGCAGATCCACTCGAGTGGATCTGCAGTTTCATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-127s21c1
Sequence:CCGGCAAGAAGGTTGTGGATCATTACTCGAGTAATGATCCACAACCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-466s21c1
Sequence:CCGGCCTGGCTGACTACAAACTGAACTCGAGTTCAGTTTGTAGTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025526.1-665s1c1
Sequence:CCGGCGTGTGTCCTTAGTGCAGTTACTCGAGTAACTGCACTAAGGACACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025526.4-232s21c1
Sequence:CCGGCGTCATGAAACTGCAGATCCACTCGAGTGGATCTGCAGTTTCATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025526.1-126s1c1
Sequence:CCGGCACAAGAAGGTTGTGGATCATCTCGAGATGATCCACAACCTTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014301
VALIDATED
ISCU MISSION shRNA Bacterial Glycerol Stock
iron-sulfur cluster assembly enzyme
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-403s21c1
Sequence:CCGGGCATGTGGTGACGTAATGAAACTCGAGTTTCATTACGTCACCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-452s21c1
Sequence:CCGGAGATTGTGGATGCTAGGTTTACTCGAGTAAACCTAGCATCCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-351s21c1
Sequence:CCGGGTCCCTTGACAAGACATCTAACTCGAGTTAGATGTCTTGTCAAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-263s1c1
Sequence:CCGGGTCCCTTGACAAGACATCTAACTCGAGTTAGATGTCTTGTCAAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-648s21c1
Sequence:CCGGCCTGGCTGATTACAAATTGAACTCGAGTTCAATTTGTAATCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-315s1c1
Sequence:CCGGGCATGTGGTGACGTAATGAAACTCGAGTTTCATTACGTCACCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-503s21c1
Sequence:CCGGCCAGCTCATTAGCCACTGAATCTCGAGATTCAGTGGCTAATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-415s1c1
Sequence:CCGGCCAGCTCATTAGCCACTGAATCTCGAGATTCAGTGGCTAATGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-364s1c1
Sequence:CCGGAGATTGTGGATGCTAGGTTTACTCGAGTAAACCTAGCATCCACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-560s1c1
Sequence:CCGGCCTGGCTGATTACAAATTGAACTCGAGTTCAATTTGTAATCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014301
VALIDATED
ISCU MISSION shRNA shRNA Plasmid DNA
iron-sulfur cluster assembly enzyme
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-403s21c1
Sequence:CCGGGCATGTGGTGACGTAATGAAACTCGAGTTTCATTACGTCACCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-452s21c1
Sequence:CCGGAGATTGTGGATGCTAGGTTTACTCGAGTAAACCTAGCATCCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-351s21c1
Sequence:CCGGGTCCCTTGACAAGACATCTAACTCGAGTTAGATGTCTTGTCAAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-263s1c1
Sequence:CCGGGTCCCTTGACAAGACATCTAACTCGAGTTAGATGTCTTGTCAAGGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-648s21c1
Sequence:CCGGCCTGGCTGATTACAAATTGAACTCGAGTTCAATTTGTAATCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-315s1c1
Sequence:CCGGGCATGTGGTGACGTAATGAAACTCGAGTTTCATTACGTCACCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-503s21c1
Sequence:CCGGCCAGCTCATTAGCCACTGAATCTCGAGATTCAGTGGCTAATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-415s1c1
Sequence:CCGGCCAGCTCATTAGCCACTGAATCTCGAGATTCAGTGGCTAATGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-364s1c1
Sequence:CCGGAGATTGTGGATGCTAGGTTTACTCGAGTAAACCTAGCATCCACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-560s1c1
Sequence:CCGGCCTGGCTGATTACAAATTGAACTCGAGTTCAATTTGTAATCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014301
VALIDATED
ISCU MISSION shRNA Lentiviral Transduction Particles
iron-sulfur cluster assembly enzyme
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-403s21c1
Sequence:CCGGGCATGTGGTGACGTAATGAAACTCGAGTTTCATTACGTCACCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-452s21c1
Sequence:CCGGAGATTGTGGATGCTAGGTTTACTCGAGTAAACCTAGCATCCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-351s21c1
Sequence:CCGGGTCCCTTGACAAGACATCTAACTCGAGTTAGATGTCTTGTCAAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-263s1c1
Sequence:CCGGGTCCCTTGACAAGACATCTAACTCGAGTTAGATGTCTTGTCAAGGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-648s21c1
Sequence:CCGGCCTGGCTGATTACAAATTGAACTCGAGTTCAATTTGTAATCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-315s1c1
Sequence:CCGGGCATGTGGTGACGTAATGAAACTCGAGTTTCATTACGTCACCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014301.3-503s21c1
Sequence:CCGGCCAGCTCATTAGCCACTGAATCTCGAGATTCAGTGGCTAATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-415s1c1
Sequence:CCGGCCAGCTCATTAGCCACTGAATCTCGAGATTCAGTGGCTAATGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-364s1c1
Sequence:CCGGAGATTGTGGATGCTAGGTTTACTCGAGTAAACCTAGCATCCACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014301.1-560s1c1
Sequence:CCGGCCTGGCTGATTACAAATTGAACTCGAGTTCAATTTGTAATCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)