EMAIL THIS PAGE TO A FRIEND

ISG15

ISG15 ubiquitin-like modifier

47 Gene Product Result for
Synonyms: G1P2 IFI15 IP17 UCRP hUCRP
UniProtKB ID: P05161, Q5SVA4, Q7Z2G2, Q96GF0
Gene ID:
Human(9636) Summary: The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. [provided by RefSeq, Dec 2012]
Mouse(100038882) ISG15 ubiquitin-like modifier
Rat(298693) ISG15 ubiquitin-like modifier
Zebrafish(558956) ISG15 ubiquitin-like modifier
cow(281871) ISG15 ubiquitin-like modifier
dog(479575) ISG15 ubiquitin-like modifier
domestic cat(100174787) ISG15 ubiquitin-like modifier
sheep(100294592) ISG15 ubiquitin-like modifier
domestic guinea pig(100731608) ISG15 ubiquitin-like modifier
naked mole-rat(101725499) ISG15 ubiquitin-like modifier
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005101 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005101 Rosetta Predictions human pricing
NM_001106700 Rosetta Predictions rat pricing
XM_001471686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066387 predicted 373
2 SASI_Hs01_00066388 predicted 311
3 SASI_Hs01_00066389 predicted 306
4 SASI_Hs01_00066390 predicted 314
5 SASI_Hs01_00066391 predicted 303
6 SASI_Hs01_00066392 predicted 225
7 SASI_Hs02_00338985 predicted 379
8 SASI_Hs01_00066393 predicted 280
9 SASI_Hs01_00066395 predicted 215
10 SASI_Hs01_00066396 predicted 271
11 SASI_Hs01_00066394 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221528 predicted 278
2 SASI_Rn02_00221529 predicted 315
3 SASI_Rn02_00221530 predicted 296
4 SASI_Rn02_00221531 predicted 442
5 SASI_Rn02_00221532 predicted 277
6 SASI_Rn02_00221533 predicted 194
7 SASI_Rn02_00221534 predicted 317
8 SASI_Rn02_00221535 predicted 342
9 SASI_Rn02_00221536 predicted 437
10 SASI_Rn02_00221537 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001471686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00357360 predicted 248
2 SASI_Mm02_00357361 predicted 377
3 SASI_Mm02_00357362 predicted 276
4 SASI_Mm02_00357363 predicted 306
5 SASI_Mm02_00357364 predicted 309
6 SASI_Mm02_00357365 predicted 249
7 SASI_Mm02_00357366 predicted 384
8 SASI_Mm02_00357367 predicted 243
9 SASI_Mm02_00357368 predicted 244
10 SASI_Mm02_00357369 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005101
VALIDATED
ISG15 MISSION shRNA Bacterial Glycerol Stock
ISG15 ubiquitin-like modifier
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-422s21c1
Sequence:CCGGCCACCTGAAGCAGCAAGTGAGCTCGAGCTCACTTGCTGCTTCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-465s21c1
Sequence:CCGGGACCTGTTCTGGCTGACCTTCCTCGAGGAAGGTCAGCCAGAACAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-352s21c1
Sequence:CCGGTGAGCATCCTGGTGAGGAATACTCGAGTATTCCTCACCAGGATGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-319s21c1
Sequence:CCGGTCCTGCTGGTGGTGGACAAATCTCGAGATTTGTCCACCACCAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-184s21c1
Sequence:CCGGCAGAGCTGAAGGCGCAGATCACTCGAGTGATCTGCGCCTTCAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-163s1c1
Sequence:CCGGGCGCAGATCACCCAGAAGATTCTCGAGAATCTTCTGGGTGATCTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005101.1-319s1c1
Sequence:CCGGCTGAGCATCCTGGTGAGGAATCTCGAGATTCCTCACCAGGATGCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-295s1c1
Sequence:CCGGGTGGTGGACAAATGCGACGAACTCGAGTTCGTCGCATTTGTCCACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-378s1c1
Sequence:CCGGGCAGACCGTGGCCCACCTGAACTCGAGTTCAGGTGGGCCACGGTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005101.1-141s1c1
Sequence:CCGGCATGTCGGTGTCAGAGCTGAACTCGAGTTCAGCTCTGACACCGACATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005101
VALIDATED
ISG15 MISSION shRNA shRNA Plasmid DNA
ISG15 ubiquitin-like modifier
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-422s21c1
Sequence:CCGGCCACCTGAAGCAGCAAGTGAGCTCGAGCTCACTTGCTGCTTCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-465s21c1
Sequence:CCGGGACCTGTTCTGGCTGACCTTCCTCGAGGAAGGTCAGCCAGAACAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-352s21c1
Sequence:CCGGTGAGCATCCTGGTGAGGAATACTCGAGTATTCCTCACCAGGATGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-319s21c1
Sequence:CCGGTCCTGCTGGTGGTGGACAAATCTCGAGATTTGTCCACCACCAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-184s21c1
Sequence:CCGGCAGAGCTGAAGGCGCAGATCACTCGAGTGATCTGCGCCTTCAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-163s1c1
Sequence:CCGGGCGCAGATCACCCAGAAGATTCTCGAGAATCTTCTGGGTGATCTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005101.1-319s1c1
Sequence:CCGGCTGAGCATCCTGGTGAGGAATCTCGAGATTCCTCACCAGGATGCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-295s1c1
Sequence:CCGGGTGGTGGACAAATGCGACGAACTCGAGTTCGTCGCATTTGTCCACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-378s1c1
Sequence:CCGGGCAGACCGTGGCCCACCTGAACTCGAGTTCAGGTGGGCCACGGTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005101.1-141s1c1
Sequence:CCGGCATGTCGGTGTCAGAGCTGAACTCGAGTTCAGCTCTGACACCGACATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005101
VALIDATED
ISG15 MISSION shRNA Lentiviral Transduction Particles
ISG15 ubiquitin-like modifier
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-422s21c1
Sequence:CCGGCCACCTGAAGCAGCAAGTGAGCTCGAGCTCACTTGCTGCTTCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-465s21c1
Sequence:CCGGGACCTGTTCTGGCTGACCTTCCTCGAGGAAGGTCAGCCAGAACAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-352s21c1
Sequence:CCGGTGAGCATCCTGGTGAGGAATACTCGAGTATTCCTCACCAGGATGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-319s21c1
Sequence:CCGGTCCTGCTGGTGGTGGACAAATCTCGAGATTTGTCCACCACCAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005101.3-184s21c1
Sequence:CCGGCAGAGCTGAAGGCGCAGATCACTCGAGTGATCTGCGCCTTCAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-163s1c1
Sequence:CCGGGCGCAGATCACCCAGAAGATTCTCGAGAATCTTCTGGGTGATCTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_005101.1-319s1c1
Sequence:CCGGCTGAGCATCCTGGTGAGGAATCTCGAGATTCCTCACCAGGATGCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-295s1c1
Sequence:CCGGGTGGTGGACAAATGCGACGAACTCGAGTTCGTCGCATTTGTCCACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005101.1-378s1c1
Sequence:CCGGGCAGACCGTGGCCCACCTGAACTCGAGTTCAGGTGGGCCACGGTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005101.1-141s1c1
Sequence:CCGGCATGTCGGTGTCAGAGCTGAACTCGAGTTCAGCTCTGACACCGACATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)