EMAIL THIS PAGE TO A FRIEND

ISG20

interferon stimulated exonuclease gene 20kDa

109 Gene Product Result for
Synonyms: CD25 HEM45
UniProtKB ID: Q96AZ6, O00441, O00586
Gene ID:
Mouse(57444) interferon-stimulated protein
Rat(293052) interferon stimulated exonuclease gene 20
sheep(101116513) interferon stimulated exonuclease gene 20kDa
domestic guinea pig(100730384) interferon stimulated exonuclease gene 20kDa
naked mole-rat(101696638) interferon stimulated exonuclease gene 20kDa
dog(488729) interferon stimulated exonuclease gene 20kDa
cow(506604) interferon stimulated exonuclease gene 20kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020583 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020583 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020583 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002201 Rosetta Predictions human pricing
NM_001008510 Rosetta Predictions rat pricing
XM_001064354 Rosetta Predictions rat pricing
NM_001113527 Rosetta Predictions mouse pricing
NM_020583 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192114 predicted 546
2 SASI_Hs01_00192115 predicted 431
3 SASI_Hs01_00192116 predicted 369
4 SASI_Hs01_00192118 predicted 695
5 SASI_Hs01_00192119 predicted 348
6 SASI_Hs01_00192120 predicted 431
7 SASI_Hs01_00192121 predicted 396
8 SASI_Hs01_00192122 predicted 505
9 SASI_Hs01_00192123 predicted 364
10 SASI_Hs02_00333423 predicted 423
11 SASI_Hs01_00192117 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037950 predicted 204
2 SASI_Rn01_00037951 predicted 503
3 SASI_Rn01_00037952 predicted 502
4 SASI_Rn01_00037953 predicted 264
5 SASI_Rn01_00037954 predicted 253
6 SASI_Rn01_00037955 predicted 248
7 SASI_Rn01_00037956 predicted 500
8 SASI_Rn01_00037957 predicted 321
9 SASI_Rn02_00199182 predicted 290
10 SASI_Rn01_00037958 predicted 346
11 SASI_Rn01_00037959 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310141 predicted 440
2 SASI_Rn02_00310142 predicted 447
3 SASI_Rn02_00310143 predicted 202
4 SASI_Rn02_00310144 predicted 259
5 SASI_Rn02_00310145 predicted 415
6 SASI_Rn02_00310146 predicted 199
7 SASI_Rn02_00310147 predicted 444
8 SASI_Rn02_00310148 predicted 258
9 SASI_Rn02_00310149 predicted 239
10 SASI_Rn02_00310150 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308063 predicted 506
2 SASI_Mm02_00308064 predicted 337
3 SASI_Mm02_00308065 predicted 419
4 SASI_Mm02_00308066 predicted 374
5 SASI_Mm02_00308067 predicted 331
6 SASI_Mm02_00308068 predicted 409
7 SASI_Mm02_00308069 predicted 563
8 SASI_Mm02_00308070 predicted 351
9 SASI_Mm02_00308071 predicted 499
10 SASI_Mm02_00308072 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020583 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025964 predicted 702
2 SASI_Mm01_00025965 predicted 439
3 SASI_Mm01_00025966 predicted 530
4 SASI_Mm01_00025967 predicted 604
5 SASI_Mm01_00025968 predicted 402
6 SASI_Mm01_00025969 predicted 565
7 SASI_Mm01_00025970 predicted 379
8 SASI_Mm01_00025971 predicted 515
9 SASI_Mm01_00025972 predicted 597
10 SASI_Mm01_00025973 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002201
VALIDATED
ISG20 MISSION shRNA Bacterial Glycerol Stock
interferon stimulated exonuclease gene 20kDa
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-762s1c1
Sequence:CCGGGCAACGATGGAGCTCTATCAACTCGAGTTGATAGAGCTCCATCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-428s1c1
Sequence:CCGGTGAGGGAGAGATCACCGATTACTCGAGTAATCGGTGATCTCTCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-569s1c1
Sequence:CCGGGCACGACTTCCAGGCACTGAACTCGAGTTCAGTGCCTGGAAGTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-776s1c1
Sequence:CCGGCTATCAAATCTCCCAGAGAATCTCGAGATTCTCTGGGAGATTTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-704s1c1
Sequence:CCGGCCTGCACAAGAGCATCCAGAACTCGAGTTCTGGATGCTCTTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-442s21c1
Sequence:CCGGCCGATTACAGAACCCGGGTCACTCGAGTGACCCGGGTTCTGTAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-733s21c1
Sequence:CCGGTTGGACACAGCTCGGTGGAAGCTCGAGCTTCCACCGAGCTGTGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-594s21c1
Sequence:CCGGGACATGAGCGGCTACACAATCCTCGAGGATTGTGTAGCCGCTCATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-612s21c1
Sequence:CCGGATCTACGACACGTCCACTGACCTCGAGGTCAGTGGACGTGTCGTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-542s21c1
Sequence:CCGGCAAGCTGGTGGTGGGTCATGACTCGAGTCATGACCCACCACCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-557s21c1
Sequence:CCGGTCATGACCTGAAGCACGACTTCTCGAGAAGTCGTGCTTCAGGTCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-399s21c1
Sequence:CCGGGCTGTGCTGTACGACAAGTTCCTCGAGGAACTTGTCGTACAGCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-580s21c1
Sequence:CCGGAGGCACTGAAAGAGGACATGACTCGAGTCATGTCCTCTTTCAGTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002201
VALIDATED
ISG20 MISSION shRNA shRNA Plasmid DNA
interferon stimulated exonuclease gene 20kDa
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-762s1c1
Sequence:CCGGGCAACGATGGAGCTCTATCAACTCGAGTTGATAGAGCTCCATCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-428s1c1
Sequence:CCGGTGAGGGAGAGATCACCGATTACTCGAGTAATCGGTGATCTCTCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-569s1c1
Sequence:CCGGGCACGACTTCCAGGCACTGAACTCGAGTTCAGTGCCTGGAAGTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-776s1c1
Sequence:CCGGCTATCAAATCTCCCAGAGAATCTCGAGATTCTCTGGGAGATTTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-704s1c1
Sequence:CCGGCCTGCACAAGAGCATCCAGAACTCGAGTTCTGGATGCTCTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-442s21c1
Sequence:CCGGCCGATTACAGAACCCGGGTCACTCGAGTGACCCGGGTTCTGTAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-733s21c1
Sequence:CCGGTTGGACACAGCTCGGTGGAAGCTCGAGCTTCCACCGAGCTGTGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-594s21c1
Sequence:CCGGGACATGAGCGGCTACACAATCCTCGAGGATTGTGTAGCCGCTCATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-612s21c1
Sequence:CCGGATCTACGACACGTCCACTGACCTCGAGGTCAGTGGACGTGTCGTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-542s21c1
Sequence:CCGGCAAGCTGGTGGTGGGTCATGACTCGAGTCATGACCCACCACCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-557s21c1
Sequence:CCGGTCATGACCTGAAGCACGACTTCTCGAGAAGTCGTGCTTCAGGTCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-399s21c1
Sequence:CCGGGCTGTGCTGTACGACAAGTTCCTCGAGGAACTTGTCGTACAGCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-580s21c1
Sequence:CCGGAGGCACTGAAAGAGGACATGACTCGAGTCATGTCCTCTTTCAGTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002201
VALIDATED
ISG20 MISSION shRNA Lentiviral Transduction Particles
interferon stimulated exonuclease gene 20kDa
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-762s1c1
Sequence:CCGGGCAACGATGGAGCTCTATCAACTCGAGTTGATAGAGCTCCATCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-428s1c1
Sequence:CCGGTGAGGGAGAGATCACCGATTACTCGAGTAATCGGTGATCTCTCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-569s1c1
Sequence:CCGGGCACGACTTCCAGGCACTGAACTCGAGTTCAGTGCCTGGAAGTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-776s1c1
Sequence:CCGGCTATCAAATCTCCCAGAGAATCTCGAGATTCTCTGGGAGATTTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_002201.4-704s1c1
Sequence:CCGGCCTGCACAAGAGCATCCAGAACTCGAGTTCTGGATGCTCTTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-442s21c1
Sequence:CCGGCCGATTACAGAACCCGGGTCACTCGAGTGACCCGGGTTCTGTAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-733s21c1
Sequence:CCGGTTGGACACAGCTCGGTGGAAGCTCGAGCTTCCACCGAGCTGTGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-594s21c1
Sequence:CCGGGACATGAGCGGCTACACAATCCTCGAGGATTGTGTAGCCGCTCATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-612s21c1
Sequence:CCGGATCTACGACACGTCCACTGACCTCGAGGTCAGTGGACGTGTCGTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-542s21c1
Sequence:CCGGCAAGCTGGTGGTGGGTCATGACTCGAGTCATGACCCACCACCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-557s21c1
Sequence:CCGGTCATGACCTGAAGCACGACTTCTCGAGAAGTCGTGCTTCAGGTCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-399s21c1
Sequence:CCGGGCTGTGCTGTACGACAAGTTCCTCGAGGAACTTGTCGTACAGCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002201.4-580s21c1
Sequence:CCGGAGGCACTGAAAGAGGACATGACTCGAGTCATGTCCTCTTTCAGTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020583
VALIDATED
ISG20 MISSION shRNA Bacterial Glycerol Stock
interferon stimulated exonuclease gene 20kDa
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020583.4-829s1c1
Sequence:CCGGCTCCTCAAGTTCTCCATGAATCTCGAGATTCATGGAGAACTTGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020583.4-661s1c1
Sequence:CCGGGCTACACAAGAACATCCAGAACTCGAGTTCTGGATGTTCTTGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020583.4-544s1c1
Sequence:CCGGGAAGGAGGATATGAGCAAGTACTCGAGTACTTGCTCATATCCTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020583.4-518s1c1
Sequence:CCGGGACCTGAAGCACGACTTCAATCTCGAGATTGAAGTCGTGCTTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020583.5-904s21c1
Sequence:CCGGAGACCTGTTTCTAACAACCACCTCGAGGTGGTTGTTAGAAACAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-411s21c1
Sequence:GTACCGGAGTCCTGTATGACAAGTACATCTCGAGATGTACTTGTCATACAGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020583.5-855s21c1
Sequence:CCGGATCCTCATCCAGGGTTAGAAGCTCGAGCTTCTAACCCTGGATGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-440s21c1
Sequence:CCGGAGGGAGAGATCACGGACTACACTCGAGTGTAGTCCGTGATCTCTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-659s21c1
Sequence:CCGGAGGCCAAGCTGCAGTACTACACTCGAGTGTAGTACTGCAGCTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-381s21c1
Sequence:CCGGCCGCTGCAGCATTGTGAACATCTCGAGATGTTCACAATGCTGCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-571s21c1
Sequence:CCGGGACCTGAAGCACGACTTCAATCTCGAGATTGAAGTCGTGCTTCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-513s21c1
Sequence:CCGGTGGTGAAGCCAGGCTAGAGATCTCGAGATCTCTAGCCTGGCTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020583
VALIDATED
ISG20 MISSION shRNA shRNA Plasmid DNA
interferon stimulated exonuclease gene 20kDa
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020583.4-829s1c1
Sequence:CCGGCTCCTCAAGTTCTCCATGAATCTCGAGATTCATGGAGAACTTGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020583.4-661s1c1
Sequence:CCGGGCTACACAAGAACATCCAGAACTCGAGTTCTGGATGTTCTTGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020583.4-544s1c1
Sequence:CCGGGAAGGAGGATATGAGCAAGTACTCGAGTACTTGCTCATATCCTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020583.4-518s1c1
Sequence:CCGGGACCTGAAGCACGACTTCAATCTCGAGATTGAAGTCGTGCTTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020583.5-904s21c1
Sequence:CCGGAGACCTGTTTCTAACAACCACCTCGAGGTGGTTGTTAGAAACAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-411s21c1
Sequence:GTACCGGAGTCCTGTATGACAAGTACATCTCGAGATGTACTTGTCATACAGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020583.5-855s21c1
Sequence:CCGGATCCTCATCCAGGGTTAGAAGCTCGAGCTTCTAACCCTGGATGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-440s21c1
Sequence:CCGGAGGGAGAGATCACGGACTACACTCGAGTGTAGTCCGTGATCTCTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-659s21c1
Sequence:CCGGAGGCCAAGCTGCAGTACTACACTCGAGTGTAGTACTGCAGCTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-381s21c1
Sequence:CCGGCCGCTGCAGCATTGTGAACATCTCGAGATGTTCACAATGCTGCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-571s21c1
Sequence:CCGGGACCTGAAGCACGACTTCAATCTCGAGATTGAAGTCGTGCTTCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-513s21c1
Sequence:CCGGTGGTGAAGCCAGGCTAGAGATCTCGAGATCTCTAGCCTGGCTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020583
VALIDATED
ISG20 MISSION shRNA Lentiviral Transduction Particles
interferon stimulated exonuclease gene 20kDa
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020583.4-829s1c1
Sequence:CCGGCTCCTCAAGTTCTCCATGAATCTCGAGATTCATGGAGAACTTGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020583.4-661s1c1
Sequence:CCGGGCTACACAAGAACATCCAGAACTCGAGTTCTGGATGTTCTTGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020583.4-544s1c1
Sequence:CCGGGAAGGAGGATATGAGCAAGTACTCGAGTACTTGCTCATATCCTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020583.4-518s1c1
Sequence:CCGGGACCTGAAGCACGACTTCAATCTCGAGATTGAAGTCGTGCTTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020583.5-904s21c1
Sequence:CCGGAGACCTGTTTCTAACAACCACCTCGAGGTGGTTGTTAGAAACAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-411s21c1
Sequence:GTACCGGAGTCCTGTATGACAAGTACATCTCGAGATGTACTTGTCATACAGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020583.5-855s21c1
Sequence:CCGGATCCTCATCCAGGGTTAGAAGCTCGAGCTTCTAACCCTGGATGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-440s21c1
Sequence:CCGGAGGGAGAGATCACGGACTACACTCGAGTGTAGTCCGTGATCTCTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-659s21c1
Sequence:CCGGAGGCCAAGCTGCAGTACTACACTCGAGTGTAGTACTGCAGCTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-381s21c1
Sequence:CCGGCCGCTGCAGCATTGTGAACATCTCGAGATGTTCACAATGCTGCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-571s21c1
Sequence:CCGGGACCTGAAGCACGACTTCAATCTCGAGATTGAAGTCGTGCTTCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020583.5-513s21c1
Sequence:CCGGTGGTGAAGCCAGGCTAGAGATCTCGAGATCTCTAGCCTGGCTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)