EMAIL THIS PAGE TO A FRIEND

ISG20L2

interferon stimulated exonuclease gene 20kDa-like 2

73 Gene Product Result for
UniProtKB ID: Q9H9L3, D3DVC6, Q64KA2
Gene ID:
Mouse(229504) interferon stimulated exonuclease gene 20-like 2
Rat(361977) interferon stimulated exonuclease gene 20-like 2
Zebrafish(558447) interferon stimulated exonuclease gene 20-like 2
cow(515980) interferon stimulated exonuclease gene 20kDa-like 2
domestic cat(101082877) interferon stimulated exonuclease gene 20kDa-like 2
dog(490409) interferon stimulated exonuclease gene 20kDa-like 2
chicken(768992) interferon stimulated exonuclease gene 20kDa-like 2
domestic guinea pig(100715161) interferon stimulated exonuclease gene 20kDa-like 2
naked mole-rat(101720672) interferon stimulated exonuclease gene 20kDa-like 2
sheep(101107241) interferon stimulated exonuclease gene 20kDa-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030980 Rosetta Predictions human pricing
NM_001007741 Rosetta Predictions rat pricing
NM_177663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178666 predicted 648
2 SASI_Hs01_00178668 predicted 1451
3 SASI_Hs01_00178670 predicted 1529
4 SASI_Hs01_00178671 predicted 781
5 SASI_Hs02_00358581 predicted 1532
6 SASI_Hs02_00358582 predicted 849
7 SASI_Hs02_00358583 predicted 879
8 SASI_Hs01_00178673 predicted 838
9 SASI_Hs01_00178674 predicted 495
10 SASI_Hs02_00358584 predicted 885
11 SASI_Hs01_00178665 predicted 426
12 SASI_Hs01_00178667 predicted 588
13 SASI_Hs01_00178669 predicted 1454
14 SASI_Hs01_00178672 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095097 predicted 1195
2 SASI_Rn01_00095098 predicted 965
3 SASI_Rn01_00095100 predicted 438
4 SASI_Rn01_00095101 predicted 494
5 SASI_Rn01_00095102 predicted 600
6 SASI_Rn01_00095103 predicted 1066
7 SASI_Rn01_00095104 predicted 451
8 SASI_Rn01_00095105 predicted 392
9 SASI_Rn01_00095106 predicted 878
10 SASI_Rn02_00198931 predicted 1186
11 SASI_Rn01_00095099 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347957 predicted 1646
2 SASI_Mm02_00347958 predicted 1390
3 SASI_Mm02_00347959 predicted 451
4 SASI_Mm02_00347960 predicted 1042
5 SASI_Mm02_00347961 predicted 1650
6 SASI_Mm02_00347962 predicted 1094
7 SASI_Mm02_00347963 predicted 499
8 SASI_Mm02_00347964 predicted 929
9 SASI_Mm02_00347965 predicted 1388
10 SASI_Mm02_00347966 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177663
VALIDATED
ISG20L2 MISSION shRNA Bacterial Glycerol Stock
interferon stimulated exonuclease gene 20kDa-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-1236s1c1
Sequence:CCGGCGGAGTCAGATCTTGAAGATACTCGAGTATCTTCAAGATCTGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-590s1c1
Sequence:CCGGCCCTAACAAGGTGTCTAAGTTCTCGAGAACTTAGACACCTTGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177663.2-518s1c1
Sequence:CCGGCAAACATCAACGCTTTGTCAACTCGAGTTGACAAAGCGTTGATGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-977s1c1
Sequence:CCGGCCAAGCTCGTTCTGAAGATAACTCGAGTTATCTTCAGAACGAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-2522s1c1
Sequence:CCGGGCTCAGCATAATGGTCTGTAACTCGAGTTACAGACCATTATGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177663
VALIDATED
ISG20L2 MISSION shRNA shRNA Plasmid DNA
interferon stimulated exonuclease gene 20kDa-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-1236s1c1
Sequence:CCGGCGGAGTCAGATCTTGAAGATACTCGAGTATCTTCAAGATCTGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-590s1c1
Sequence:CCGGCCCTAACAAGGTGTCTAAGTTCTCGAGAACTTAGACACCTTGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177663.2-518s1c1
Sequence:CCGGCAAACATCAACGCTTTGTCAACTCGAGTTGACAAAGCGTTGATGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-977s1c1
Sequence:CCGGCCAAGCTCGTTCTGAAGATAACTCGAGTTATCTTCAGAACGAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-2522s1c1
Sequence:CCGGGCTCAGCATAATGGTCTGTAACTCGAGTTACAGACCATTATGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177663
VALIDATED
ISG20L2 MISSION shRNA Lentiviral Transduction Particles
interferon stimulated exonuclease gene 20kDa-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-1236s1c1
Sequence:CCGGCGGAGTCAGATCTTGAAGATACTCGAGTATCTTCAAGATCTGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-590s1c1
Sequence:CCGGCCCTAACAAGGTGTCTAAGTTCTCGAGAACTTAGACACCTTGTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177663.2-518s1c1
Sequence:CCGGCAAACATCAACGCTTTGTCAACTCGAGTTGACAAAGCGTTGATGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-977s1c1
Sequence:CCGGCCAAGCTCGTTCTGAAGATAACTCGAGTTATCTTCAGAACGAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177663.2-2522s1c1
Sequence:CCGGGCTCAGCATAATGGTCTGTAACTCGAGTTACAGACCATTATGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030980
VALIDATED
ISG20L2 MISSION shRNA Bacterial Glycerol Stock
interferon stimulated exonuclease gene 20kDa-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1247s21c1
Sequence:CCGGAGGCCACCATGGAGCTATATACTCGAGTATATAGCTCCATGGTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1673s21c1
Sequence:CCGGTTATCACTTGGGTGGACATATCTCGAGATATGTCCACCCAAGTGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-323s21c1
Sequence:CCGGGAAATGCCAAGCACCGAAATTCTCGAGAATTTCGGTGCTTGGCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1064s21c1
Sequence:CCGGTCAAAGCCCTTCAGTACTTTCCTCGAGGAAAGTACTGAAGGGCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1185s21c1
Sequence:CCGGGAAGCTGCTAAACCGGGATATCTCGAGATATCCCGGTTTAGCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030980
VALIDATED
ISG20L2 MISSION shRNA shRNA Plasmid DNA
interferon stimulated exonuclease gene 20kDa-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1247s21c1
Sequence:CCGGAGGCCACCATGGAGCTATATACTCGAGTATATAGCTCCATGGTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1673s21c1
Sequence:CCGGTTATCACTTGGGTGGACATATCTCGAGATATGTCCACCCAAGTGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-323s21c1
Sequence:CCGGGAAATGCCAAGCACCGAAATTCTCGAGAATTTCGGTGCTTGGCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1064s21c1
Sequence:CCGGTCAAAGCCCTTCAGTACTTTCCTCGAGGAAAGTACTGAAGGGCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1185s21c1
Sequence:CCGGGAAGCTGCTAAACCGGGATATCTCGAGATATCCCGGTTTAGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030980
VALIDATED
ISG20L2 MISSION shRNA Lentiviral Transduction Particles
interferon stimulated exonuclease gene 20kDa-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1247s21c1
Sequence:CCGGAGGCCACCATGGAGCTATATACTCGAGTATATAGCTCCATGGTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1673s21c1
Sequence:CCGGTTATCACTTGGGTGGACATATCTCGAGATATGTCCACCCAAGTGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-323s21c1
Sequence:CCGGGAAATGCCAAGCACCGAAATTCTCGAGAATTTCGGTGCTTGGCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1064s21c1
Sequence:CCGGTCAAAGCCCTTCAGTACTTTCCTCGAGGAAAGTACTGAAGGGCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_030980.1-1185s21c1
Sequence:CCGGGAAGCTGCTAAACCGGGATATCTCGAGATATCCCGGTTTAGCAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)