EMAIL THIS PAGE TO A FRIEND

ISL1

ISL LIM homeobox 1

135 Gene Product Result for
Synonyms: ISLET1 Isl-1
UniProtKB ID: P61371, P20663, P47894
Gene ID:
Human(3670) Summary: This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young. [provided by RefSeq, Jul 2008]
Mouse(16392) ISL1 transcription factor, LIM/homeodomain
Rat(64444) ISL LIM homeobox 1
domestic cat(101090235) ISL LIM homeobox 1
cow(614040) ISL LIM homeobox 1
Horse(100052482) ISL LIM homeobox 1
dog(612954) ISL LIM homeobox 1
chicken(396383) ISL LIM homeobox 1
sheep(541604) ISL LIM homeobox 1
domestic guinea pig(100728707) ISL LIM homeobox 1
naked mole-rat(101704803) ISL LIM homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412039 ANTI-ISL1 antibody produced in mouse clone 4A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412040 ANTI-ISL1 antibody produced in mouse clone 8A3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412041 ANTI-ISL1 antibody produced in mouse clone 5F12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2702421 Anti-Isl1 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB2107885 Anti-ISL1 antibody produced in rabbit affinity isolated antibody canine, mouse, horse, rabbit, zebrafish, human, sheep, bovine, rat, pig, guinea pig
western blot pricing
AV32336 Anti-ISL1 antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, bovine, rat, human, chicken, mouse
western blot pricing
HPA057416 Anti-ISL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1410720 Anti-ISL1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, rat, human
western blot pricing
WH0003670M1 Monoclonal Anti-ISL1 antibody produced in mouse clone 1A3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403993 Monoclonal Anti-ISL1 antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, immunofluorescence, western blot pricing
SAB5300443 Monoclonal Anti-ISL1 antibody produced in mouse clone 1H9, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300444 Monoclonal Anti-ISL1 antibody produced in mouse clone 1B1, ascites fluid human
ELISA, immunofluorescence, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1534 Human Islet-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002202 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002202 Rosetta Predictions human pricing
NM_017339 Rosetta Predictions rat pricing
NM_021459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109412 predicted 1381
2 SASI_Hs01_00109413 predicted 784
3 SASI_Hs01_00109414 predicted 1207
4 SASI_Hs01_00109415 predicted 825
5 SASI_Hs01_00109416 predicted 1381
6 SASI_Hs01_00109417 predicted 2089
7 SASI_Hs01_00109418 predicted 1255
8 SASI_Hs01_00109419 predicted 1155
9 SASI_Hs01_00109420 predicted 1009
10 SASI_Hs01_00109421 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081447 predicted 301
2 SASI_Rn01_00081448 predicted 234
3 SASI_Rn02_00261798 predicted 612
4 SASI_Rn01_00081449 predicted 335
5 SASI_Rn01_00081450 predicted 288
6 SASI_Rn01_00081451 predicted 273
7 SASI_Rn01_00081452 predicted 255
8 SASI_Rn02_00261799 predicted 743
9 SASI_Rn01_00081454 predicted 837
10 SASI_Rn02_00261800 predicted 316
11 SASI_Rn01_00081445 predicted 429
12 SASI_Rn01_00081446 predicted 807
13 SASI_Rn01_00081453 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326110 predicted 877
2 SASI_Mm01_00186156 predicted 599
3 SASI_Mm01_00186157 predicted 550
4 SASI_Mm01_00186158 predicted 1107
5 SASI_Mm01_00186159 predicted 725
6 SASI_Mm01_00186160 predicted 522
7 SASI_Mm01_00186161 predicted 536
8 SASI_Mm01_00186162 predicted 1078
9 SASI_Mm01_00186163 predicted 1004
10 SASI_Mm01_00186164 predicted 907
11 SASI_Mm01_00186155 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002202
VALIDATED
ISL1 MISSION shRNA Bacterial Glycerol Stock
ISL LIM homeobox 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002202.1-1682s1c1
Sequence:CCGGGCTGTTTCTATATTGGTCATTCTCGAGAATGACCAATATAGAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002202.1-1141s1c1
Sequence:CCGGGTGACATAGATCAGCCTGCTTCTCGAGAAGCAGGCTGATCTATGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002202.1-373s1c1
Sequence:CCGGGTGCGGAGTGTAATCAGTATTCTCGAGAATACTGATTACACTCCGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002202.1-1221s1c1
Sequence:CCGGGTAGCATCAATGTCCTCTCAACTCGAGTTGAGAGGACATTGATGCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-763s21c1
Sequence:CCGGTCAGGTTGTACGGGATCAAATCTCGAGATTTGATCCCGTACAACCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-1530s21c1
Sequence:CCGGGTAGCATCAATGTCCTCTCAACTCGAGTTGAGAGGACATTGATGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-682s21c1
Sequence:CCGGGTGCGGAGTGTAATCAGTATTCTCGAGAATACTGATTACACTCCGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002202.2-1832s21c1
Sequence:CCGGTATGCTATTCAATGATCTTAGCTCGAGCTAAGATCATTGAATAGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002202
VALIDATED
ISL1 MISSION shRNA shRNA Plasmid DNA
ISL LIM homeobox 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002202.1-1682s1c1
Sequence:CCGGGCTGTTTCTATATTGGTCATTCTCGAGAATGACCAATATAGAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002202.1-1141s1c1
Sequence:CCGGGTGACATAGATCAGCCTGCTTCTCGAGAAGCAGGCTGATCTATGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002202.1-373s1c1
Sequence:CCGGGTGCGGAGTGTAATCAGTATTCTCGAGAATACTGATTACACTCCGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002202.1-1221s1c1
Sequence:CCGGGTAGCATCAATGTCCTCTCAACTCGAGTTGAGAGGACATTGATGCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-763s21c1
Sequence:CCGGTCAGGTTGTACGGGATCAAATCTCGAGATTTGATCCCGTACAACCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-1530s21c1
Sequence:CCGGGTAGCATCAATGTCCTCTCAACTCGAGTTGAGAGGACATTGATGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-682s21c1
Sequence:CCGGGTGCGGAGTGTAATCAGTATTCTCGAGAATACTGATTACACTCCGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002202.2-1832s21c1
Sequence:CCGGTATGCTATTCAATGATCTTAGCTCGAGCTAAGATCATTGAATAGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002202
VALIDATED
ISL1 MISSION shRNA Lentiviral Transduction Particles
ISL LIM homeobox 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002202.1-1682s1c1
Sequence:CCGGGCTGTTTCTATATTGGTCATTCTCGAGAATGACCAATATAGAAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002202.1-1141s1c1
Sequence:CCGGGTGACATAGATCAGCCTGCTTCTCGAGAAGCAGGCTGATCTATGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002202.1-373s1c1
Sequence:CCGGGTGCGGAGTGTAATCAGTATTCTCGAGAATACTGATTACACTCCGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002202.1-1221s1c1
Sequence:CCGGGTAGCATCAATGTCCTCTCAACTCGAGTTGAGAGGACATTGATGCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-763s21c1
Sequence:CCGGTCAGGTTGTACGGGATCAAATCTCGAGATTTGATCCCGTACAACCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-1530s21c1
Sequence:CCGGGTAGCATCAATGTCCTCTCAACTCGAGTTGAGAGGACATTGATGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002202.2-682s21c1
Sequence:CCGGGTGCGGAGTGTAATCAGTATTCTCGAGAATACTGATTACACTCCGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002202.2-1832s21c1
Sequence:CCGGTATGCTATTCAATGATCTTAGCTCGAGCTAAGATCATTGAATAGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021459
ISL1 MISSION shRNA Bacterial Glycerol Stock
ISL LIM homeobox 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-343s1c1
Sequence:CCGGGACCAGTATATTCTGAGGGTTCTCGAGAACCCTCAGAATATACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-969s1c1
Sequence:CCGGCAAGGACAAGAAACGCAGCATCTCGAGATGCTGCGTTTCTTGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-327s1c1
Sequence:CCGGCGGCAATCAAATTCACGACCACTCGAGTGGTCGTGAATTTGATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-1103s1c1
Sequence:CCGGCTAACCCAGTAGAGGTGCAAACTCGAGTTTGCACCTCTACTGGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-1159s1c1
Sequence:CCGGGCCTTGCAAAGCGACATAGATCTCGAGATCTATGTCGCTTTGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1586s21c1
Sequence:CCGGATGACCTTAGGAGTACTTAAACTCGAGTTTAAGTACTCCTAAGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1385s21c1
Sequence:CCGGTGACGTTGAACTCCGAAATAACTCGAGTTATTTCGGAGTTCAACGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1753s21c1
Sequence:CCGGGAATGGTGCTGTTTCTATATTCTCGAGAATATAGAAACAGCACCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021459.4-481s21c1
Sequence:CCGGTCAGGTTGTACGGGATCAAATCTCGAGATTTGATCCCGTACAACCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021459
ISL1 MISSION shRNA shRNA Plasmid DNA
ISL LIM homeobox 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-343s1c1
Sequence:CCGGGACCAGTATATTCTGAGGGTTCTCGAGAACCCTCAGAATATACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-969s1c1
Sequence:CCGGCAAGGACAAGAAACGCAGCATCTCGAGATGCTGCGTTTCTTGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-327s1c1
Sequence:CCGGCGGCAATCAAATTCACGACCACTCGAGTGGTCGTGAATTTGATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-1103s1c1
Sequence:CCGGCTAACCCAGTAGAGGTGCAAACTCGAGTTTGCACCTCTACTGGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-1159s1c1
Sequence:CCGGGCCTTGCAAAGCGACATAGATCTCGAGATCTATGTCGCTTTGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1586s21c1
Sequence:CCGGATGACCTTAGGAGTACTTAAACTCGAGTTTAAGTACTCCTAAGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1385s21c1
Sequence:CCGGTGACGTTGAACTCCGAAATAACTCGAGTTATTTCGGAGTTCAACGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1753s21c1
Sequence:CCGGGAATGGTGCTGTTTCTATATTCTCGAGAATATAGAAACAGCACCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021459.4-481s21c1
Sequence:CCGGTCAGGTTGTACGGGATCAAATCTCGAGATTTGATCCCGTACAACCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021459
ISL1 MISSION shRNA Lentiviral Transduction Particles
ISL LIM homeobox 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-343s1c1
Sequence:CCGGGACCAGTATATTCTGAGGGTTCTCGAGAACCCTCAGAATATACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-969s1c1
Sequence:CCGGCAAGGACAAGAAACGCAGCATCTCGAGATGCTGCGTTTCTTGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-327s1c1
Sequence:CCGGCGGCAATCAAATTCACGACCACTCGAGTGGTCGTGAATTTGATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-1103s1c1
Sequence:CCGGCTAACCCAGTAGAGGTGCAAACTCGAGTTTGCACCTCTACTGGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021459.2-1159s1c1
Sequence:CCGGGCCTTGCAAAGCGACATAGATCTCGAGATCTATGTCGCTTTGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1586s21c1
Sequence:CCGGATGACCTTAGGAGTACTTAAACTCGAGTTTAAGTACTCCTAAGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1385s21c1
Sequence:CCGGTGACGTTGAACTCCGAAATAACTCGAGTTATTTCGGAGTTCAACGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021459.4-1753s21c1
Sequence:CCGGGAATGGTGCTGTTTCTATATTCTCGAGAATATAGAAACAGCACCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021459.4-481s21c1
Sequence:CCGGTCAGGTTGTACGGGATCAAATCTCGAGATTTGATCCCGTACAACCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)