EMAIL THIS PAGE TO A FRIEND

ISL2

ISL LIM homeobox 2

57 Gene Product Result for
UniProtKB ID: Q96A47, B3KM37
Gene ID:
Mouse(104360) insulin related protein 2 (islet 2)
Rat(57233) ISL LIM homeobox 2
chicken(396382) ISL LIM homeobox 2
domestic cat(101095829) ISL LIM homeobox 2
cow(786913) ISL LIM homeobox 2
Horse(100050804) ISL LIM homeobox 2
domestic guinea pig(100731802) ISL LIM homeobox 2
naked mole-rat(101726277) ISL LIM homeobox 2
sheep(101103270) ISL LIM homeobox 2
Domestic Rabbit(100339604) ISL LIM homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145805 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145805 Rosetta Predictions human pricing
NM_020471 Rosetta Predictions rat pricing
NM_027397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025244 predicted 1244
2 SASI_Hs01_00025245 predicted 1238
3 SASI_Hs01_00025246 predicted 1236
4 SASI_Hs01_00025247 predicted 1206
5 SASI_Hs01_00025248 predicted 1289
6 SASI_Hs01_00025249 predicted 1210
7 SASI_Hs01_00025250 predicted 1009
8 SASI_Hs01_00025251 predicted 854
9 SASI_Hs01_00025252 predicted 1320
10 SASI_Hs01_00025253 predicted 1387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083662 predicted 799
2 SASI_Rn01_00083663 predicted 1016
3 SASI_Rn01_00083664 predicted 856
4 SASI_Rn01_00083665 predicted 771
5 SASI_Rn01_00083666 predicted 773
6 SASI_Rn01_00083667 predicted 311
7 SASI_Rn01_00083668 predicted 757
8 SASI_Rn01_00083670 predicted 1054
9 SASI_Rn01_00083671 predicted 331
10 SASI_Rn02_00262554 predicted 1030
11 SASI_Rn01_00083669 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332116 predicted 850
2 SASI_Mm02_00332117 predicted 827
3 SASI_Mm02_00332118 predicted 824
4 SASI_Mm02_00332119 predicted 219
5 SASI_Mm01_00078986 predicted 1106
6 SASI_Mm01_00078987 predicted 359
7 SASI_Mm01_00078988 predicted 816
8 SASI_Mm02_00332120 predicted 220
9 SASI_Mm01_00078989 predicted 1061
10 SASI_Mm02_00332121 predicted 237
11 SASI_Mm01_00078985 predicted 942
12 SASI_Mm01_00078990 predicted 859
13 SASI_Mm01_00078991 predicted 979
14 SASI_Mm01_00078992 predicted 1020
15 SASI_Mm01_00078993 predicted 883
16 SASI_Mm01_00078994 predicted 1088
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145805
ISL2 MISSION shRNA Bacterial Glycerol Stock
ISL LIM homeobox 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-111s21c1
Sequence:CCGGGGGTGCTATGGGTGATCATTCCTCGAGGAATGATCACCCATAGCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-813s21c1
Sequence:GTACCGGGGACAAGAAGAAATCCATTCTCTCGAGAGAATGGATTTCTTCTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145805.1-1645s21c1
Sequence:GTACCGGGACTTGCCTTGAAAGTGTTTACTCGAGTAAACACTTTCAAGGCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-323s21c1
Sequence:CCGGTCAGGCTGTTCGGCATCAAGTCTCGAGACTTGATGCCGAACAGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-173s21c1
Sequence:CCGGGTCAGATCCACGACCAGTTTACTCGAGTAAACTGGTCGTGGATCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-172s1c1
Sequence:CCGGAGTCAGATCCACGACCAGTTTCTCGAGAAACTGGTCGTGGATCTGACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-783s1c1
Sequence:CCGGCCGCGTCTGGTTCCAGAACAACTCGAGTTGTTCTGGAACCAGACGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-402s1c1
Sequence:CCGGCGTGTACCACATCGAGTGCTTCTCGAGAAGCACTCGATGTGGTACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-110s1c1
Sequence:CCGGTGGGTGCTATGGGTGATCATTCTCGAGAATGATCACCCATAGCACCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-859s1c1
Sequence:CCGGCACAGCGACAAGACGAGCCTTCTCGAGAAGGCTCGTCTTGTCGCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145805
ISL2 MISSION shRNA shRNA Plasmid DNA
ISL LIM homeobox 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-111s21c1
Sequence:CCGGGGGTGCTATGGGTGATCATTCCTCGAGGAATGATCACCCATAGCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-813s21c1
Sequence:GTACCGGGGACAAGAAGAAATCCATTCTCTCGAGAGAATGGATTTCTTCTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145805.1-1645s21c1
Sequence:GTACCGGGACTTGCCTTGAAAGTGTTTACTCGAGTAAACACTTTCAAGGCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-323s21c1
Sequence:CCGGTCAGGCTGTTCGGCATCAAGTCTCGAGACTTGATGCCGAACAGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-173s21c1
Sequence:CCGGGTCAGATCCACGACCAGTTTACTCGAGTAAACTGGTCGTGGATCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-172s1c1
Sequence:CCGGAGTCAGATCCACGACCAGTTTCTCGAGAAACTGGTCGTGGATCTGACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-783s1c1
Sequence:CCGGCCGCGTCTGGTTCCAGAACAACTCGAGTTGTTCTGGAACCAGACGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-402s1c1
Sequence:CCGGCGTGTACCACATCGAGTGCTTCTCGAGAAGCACTCGATGTGGTACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-110s1c1
Sequence:CCGGTGGGTGCTATGGGTGATCATTCTCGAGAATGATCACCCATAGCACCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-859s1c1
Sequence:CCGGCACAGCGACAAGACGAGCCTTCTCGAGAAGGCTCGTCTTGTCGCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145805
ISL2 MISSION shRNA Lentiviral Transduction Particles
ISL LIM homeobox 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-111s21c1
Sequence:CCGGGGGTGCTATGGGTGATCATTCCTCGAGGAATGATCACCCATAGCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-813s21c1
Sequence:GTACCGGGGACAAGAAGAAATCCATTCTCTCGAGAGAATGGATTTCTTCTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145805.1-1645s21c1
Sequence:GTACCGGGACTTGCCTTGAAAGTGTTTACTCGAGTAAACACTTTCAAGGCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-323s21c1
Sequence:CCGGTCAGGCTGTTCGGCATCAAGTCTCGAGACTTGATGCCGAACAGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145805.1-173s21c1
Sequence:CCGGGTCAGATCCACGACCAGTTTACTCGAGTAAACTGGTCGTGGATCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-172s1c1
Sequence:CCGGAGTCAGATCCACGACCAGTTTCTCGAGAAACTGGTCGTGGATCTGACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-783s1c1
Sequence:CCGGCCGCGTCTGGTTCCAGAACAACTCGAGTTGTTCTGGAACCAGACGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-402s1c1
Sequence:CCGGCGTGTACCACATCGAGTGCTTCTCGAGAAGCACTCGATGTGGTACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-110s1c1
Sequence:CCGGTGGGTGCTATGGGTGATCATTCTCGAGAATGATCACCCATAGCACCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145805.1-859s1c1
Sequence:CCGGCACAGCGACAAGACGAGCCTTCTCGAGAAGGCTCGTCTTGTCGCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027397
ISL2 MISSION shRNA Bacterial Glycerol Stock
ISL LIM homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027397.1-1249s1c1
Sequence:CCGGGCCCTTGTAATTATTGTTGTTCTCGAGAACAACAATAATTACAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-1120s1c1
Sequence:CCGGCCCAACAGTATGGTACCTAGTCTCGAGACTAGGTACCATACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-180s1c1
Sequence:CCGGCGACCAGTTTATCCTTCGCGTCTCGAGACGCGAAGGATAAACTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-976s1c1
Sequence:CCGGTGGAAAGCACTCAGCGAGTTTCTCGAGAAACTCGCTGAGTGCTTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-813s1c1
Sequence:CCGGCAAGAAGAAGTCCATTCTCATCTCGAGATGAGAATGGACTTCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027397
ISL2 MISSION shRNA shRNA Plasmid DNA
ISL LIM homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027397.1-1249s1c1
Sequence:CCGGGCCCTTGTAATTATTGTTGTTCTCGAGAACAACAATAATTACAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-1120s1c1
Sequence:CCGGCCCAACAGTATGGTACCTAGTCTCGAGACTAGGTACCATACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-180s1c1
Sequence:CCGGCGACCAGTTTATCCTTCGCGTCTCGAGACGCGAAGGATAAACTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-976s1c1
Sequence:CCGGTGGAAAGCACTCAGCGAGTTTCTCGAGAAACTCGCTGAGTGCTTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-813s1c1
Sequence:CCGGCAAGAAGAAGTCCATTCTCATCTCGAGATGAGAATGGACTTCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027397
ISL2 MISSION shRNA Lentiviral Transduction Particles
ISL LIM homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027397.1-1249s1c1
Sequence:CCGGGCCCTTGTAATTATTGTTGTTCTCGAGAACAACAATAATTACAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-1120s1c1
Sequence:CCGGCCCAACAGTATGGTACCTAGTCTCGAGACTAGGTACCATACTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-180s1c1
Sequence:CCGGCGACCAGTTTATCCTTCGCGTCTCGAGACGCGAAGGATAAACTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-976s1c1
Sequence:CCGGTGGAAAGCACTCAGCGAGTTTCTCGAGAAACTCGCTGAGTGCTTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027397.1-813s1c1
Sequence:CCGGCAAGAAGAAGTCCATTCTCATCTCGAGATGAGAATGGACTTCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)