EMAIL THIS PAGE TO A FRIEND

ISLR2

immunoglobulin superfamily containing leucine-rich repeat 2

66 Gene Product Result for
Synonyms: LINX
UniProtKB ID: Q6UXK2, A8K352, Q9P263
Gene ID:
Mouse(320563) immunoglobulin superfamily containing leucine-rich repeat 2
domestic guinea pig(100718352) immunoglobulin superfamily containing leucine-rich repeat 2
naked mole-rat(101705697) immunoglobulin superfamily containing leucine-rich repeat 2
sheep(101111321) immunoglobulin superfamily containing leucine-rich repeat 2
Zebrafish(541396) immunoglobulin superfamily containing leucine-rich repeat 2
chicken(429941) immunoglobulin superfamily containing leucine-rich repeat 2
domestic cat(101086726) immunoglobulin superfamily containing leucine-rich repeat 2
cow(617436) immunoglobulin superfamily containing leucine-rich repeat 2
dog(487642) immunoglobulin superfamily containing leucine-rich repeat 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087671 MISSION® esiRNA esiRNA targeting mouse Islr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020851 Rosetta Predictions human pricing
NM_177193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197590 predicted 297
2 SASI_Hs01_00197591 predicted 648
3 SASI_Hs01_00197592 predicted 223
4 SASI_Hs01_00197593 predicted 2510
5 SASI_Hs01_00197594 predicted 2321
6 SASI_Hs01_00197595 predicted 652
7 SASI_Hs01_00197596 predicted 440
8 SASI_Hs02_00354115 predicted 2322
9 SASI_Hs01_00197597 predicted 2336
10 SASI_Hs01_00197598 predicted 2503
11 SASI_Hs01_00197599 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183032 predicted 1873
2 SASI_Mm01_00183033 predicted 2210
3 SASI_Mm01_00183034 predicted 1046
4 SASI_Mm02_00347199 predicted 607
5 SASI_Mm01_00183035 predicted 1641
6 SASI_Mm01_00183036 predicted 1491
7 SASI_Mm01_00183037 predicted 615
8 SASI_Mm01_00183038 predicted 739
9 SASI_Mm01_00183039 predicted 1838
10 SASI_Mm01_00183040 predicted 2386
11 SASI_Mm01_00183031 predicted 2314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020851
ISLR2 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily containing leucine-rich repeat 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-1537s1c1
Sequence:CCGGCGTTTCTAACCACGCGTTCAACTCGAGTTGAACGCGTGGTTAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-664s1c1
Sequence:CCGGGCAACTCTATCACAATCCCTTCTCGAGAAGGGATTGTGATAGAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-2335s1c1
Sequence:CCGGCCAGGAGATTAATGGCAACTACTCGAGTAGTTGCCATTAATCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020851.1-2604s1c1
Sequence:CCGGCCAAGCACAGTGTTTATCTTACTCGAGTAAGATAAACACTGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-458s1c1
Sequence:CCGGCACAACTTCATATCCAGCTTTCTCGAGAAAGCTGGATATGAAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020851.2-2727s21c1
Sequence:CCGGTATTAGGGAGTGGGCCGATTTCTCGAGAAATCGGCCCACTCCCTAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020851.2-504s21c1
Sequence:CCGGCTTAGTCTGTCCGCGAACAAGCTCGAGCTTGTTCGCGGACAGACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020851.2-2849s21c1
Sequence:CCGGAGACGGTGGGCGATATCTATGCTCGAGCATAGATATCGCCCACCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020851
ISLR2 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily containing leucine-rich repeat 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-1537s1c1
Sequence:CCGGCGTTTCTAACCACGCGTTCAACTCGAGTTGAACGCGTGGTTAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-664s1c1
Sequence:CCGGGCAACTCTATCACAATCCCTTCTCGAGAAGGGATTGTGATAGAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-2335s1c1
Sequence:CCGGCCAGGAGATTAATGGCAACTACTCGAGTAGTTGCCATTAATCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020851.1-2604s1c1
Sequence:CCGGCCAAGCACAGTGTTTATCTTACTCGAGTAAGATAAACACTGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-458s1c1
Sequence:CCGGCACAACTTCATATCCAGCTTTCTCGAGAAAGCTGGATATGAAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020851.2-2727s21c1
Sequence:CCGGTATTAGGGAGTGGGCCGATTTCTCGAGAAATCGGCCCACTCCCTAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020851.2-504s21c1
Sequence:CCGGCTTAGTCTGTCCGCGAACAAGCTCGAGCTTGTTCGCGGACAGACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020851.2-2849s21c1
Sequence:CCGGAGACGGTGGGCGATATCTATGCTCGAGCATAGATATCGCCCACCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020851
ISLR2 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily containing leucine-rich repeat 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-1537s1c1
Sequence:CCGGCGTTTCTAACCACGCGTTCAACTCGAGTTGAACGCGTGGTTAGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-664s1c1
Sequence:CCGGGCAACTCTATCACAATCCCTTCTCGAGAAGGGATTGTGATAGAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-2335s1c1
Sequence:CCGGCCAGGAGATTAATGGCAACTACTCGAGTAGTTGCCATTAATCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150133    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020851.1-2604s1c1
Sequence:CCGGCCAAGCACAGTGTTTATCTTACTCGAGTAAGATAAACACTGTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020851.1-458s1c1
Sequence:CCGGCACAACTTCATATCCAGCTTTCTCGAGAAAGCTGGATATGAAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020851.2-2727s21c1
Sequence:CCGGTATTAGGGAGTGGGCCGATTTCTCGAGAAATCGGCCCACTCCCTAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020851.2-504s21c1
Sequence:CCGGCTTAGTCTGTCCGCGAACAAGCTCGAGCTTGTTCGCGGACAGACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417668    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020851.2-2849s21c1
Sequence:CCGGAGACGGTGGGCGATATCTATGCTCGAGCATAGATATCGCCCACCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177193
ISLR2 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily containing leucine-rich repeat 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177193.4-3213s1c1
Sequence:CCGGCCTTTCCTATAATGATCCAAACTCGAGTTTGGATCATTATAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-2643s1c1
Sequence:CCGGCCAGGAAATAAACGGCAACTACTCGAGTAGTTGCCGTTTATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-765s1c1
Sequence:CCGGCCACAACCTTATATCCAACTTCTCGAGAAGTTGGATATAAGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-1449s1c1
Sequence:CCGGCCTCGCAAATGGCTCTCTGTTCTCGAGAACAGAGAGCCATTTGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-1858s1c1
Sequence:CCGGGCATTCAACCAGAGCTCAGATCTCGAGATCTGAGCTCTGGTTGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177193
ISLR2 MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily containing leucine-rich repeat 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177193.4-3213s1c1
Sequence:CCGGCCTTTCCTATAATGATCCAAACTCGAGTTTGGATCATTATAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-2643s1c1
Sequence:CCGGCCAGGAAATAAACGGCAACTACTCGAGTAGTTGCCGTTTATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-765s1c1
Sequence:CCGGCCACAACCTTATATCCAACTTCTCGAGAAGTTGGATATAAGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-1449s1c1
Sequence:CCGGCCTCGCAAATGGCTCTCTGTTCTCGAGAACAGAGAGCCATTTGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-1858s1c1
Sequence:CCGGGCATTCAACCAGAGCTCAGATCTCGAGATCTGAGCTCTGGTTGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177193
ISLR2 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily containing leucine-rich repeat 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177193.4-3213s1c1
Sequence:CCGGCCTTTCCTATAATGATCCAAACTCGAGTTTGGATCATTATAGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-2643s1c1
Sequence:CCGGCCAGGAAATAAACGGCAACTACTCGAGTAGTTGCCGTTTATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-765s1c1
Sequence:CCGGCCACAACCTTATATCCAACTTCTCGAGAAGTTGGATATAAGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-1449s1c1
Sequence:CCGGCCTCGCAAATGGCTCTCTGTTCTCGAGAACAGAGAGCCATTTGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177193.4-1858s1c1
Sequence:CCGGGCATTCAACCAGAGCTCAGATCTCGAGATCTGAGCTCTGGTTGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)