EMAIL THIS PAGE TO A FRIEND

ISLR

immunoglobulin superfamily containing leucine-rich repeat

63 Gene Product Result for
Synonyms: HsT17563
UniProtKB ID: O14498
Gene ID:
Mouse(26968) immunoglobulin superfamily containing leucine-rich repeat
Rat(686539) immunoglobulin superfamily containing leucine-rich repeat
chicken(769957) immunoglobulin superfamily containing leucine-rich repeat
dog(487643) immunoglobulin superfamily containing leucine-rich repeat
domestic cat(101086481) immunoglobulin superfamily containing leucine-rich repeat
cow(515018) immunoglobulin superfamily containing leucine-rich repeat
Horse(100062667) immunoglobulin superfamily containing leucine-rich repeat
sheep(101110878) immunoglobulin superfamily containing leucine-rich repeat
domestic guinea pig(100721106) immunoglobulin superfamily containing leucine-rich repeat
naked mole-rat(101705319) immunoglobulin superfamily containing leucine-rich repeat
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005545 Rosetta Predictions human pricing
NM_201526 Rosetta Predictions human pricing
NM_001126300 Rosetta Predictions rat pricing
NM_012043 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339787 predicted 381
2 SASI_Hs01_00097979 predicted 1725
3 SASI_Hs01_00097980 predicted 630
4 SASI_Hs01_00097981 predicted 1737
5 SASI_Hs01_00097982 predicted 596
6 SASI_Hs01_00097983 predicted 1676
7 SASI_Hs01_00097985 predicted 740
8 SASI_Hs01_00097986 predicted 1345
9 SASI_Hs01_00097987 predicted 583
10 SASI_Hs02_00339788 predicted 2004
11 SASI_Hs01_00097978 predicted 1390
12 SASI_Hs01_00097984 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373007 predicted 198
2 SASI_Hs01_00047601 predicted 1535
3 SASI_Hs01_00047602 predicted 452
4 SASI_Hs01_00047603 predicted 1558
5 SASI_Hs01_00047604 predicted 407
6 SASI_Hs01_00047605 predicted 1497
7 SASI_Hs01_00047607 predicted 553
8 SASI_Hs01_00047608 predicted 1163
9 SASI_Hs01_00047609 predicted 403
10 SASI_Hs02_00373008 predicted 1817
11 SASI_Hs01_00047600 predicted 1200
12 SASI_Hs01_00047606 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253373 predicted 1527
2 SASI_Rn02_00253374 predicted 1562
3 SASI_Rn02_00253375 predicted 1556
4 SASI_Rn02_00253376 predicted 810
5 SASI_Rn02_00253377 predicted 1193
6 SASI_Rn02_00253378 predicted 1479
7 SASI_Rn02_00253379 predicted 1234
8 SASI_Rn02_00253380 predicted 936
9 SASI_Rn02_00253381 predicted 805
10 SASI_Rn02_00253382 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199985 predicted 1682
2 SASI_Mm01_00199986 predicted 261
3 SASI_Mm01_00199987 predicted 1704
4 SASI_Mm01_00199988 predicted 1646
5 SASI_Mm01_00199989 predicted 1422
6 SASI_Mm01_00199990 predicted 1769
7 SASI_Mm02_00322011 predicted 1521
8 SASI_Mm01_00199992 predicted 1765
9 SASI_Mm01_00199993 predicted 1812
10 SASI_Mm01_00199994 predicted 1788
11 SASI_Mm01_00199991 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005545
ISLR MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily containing leucine-rich repeat
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-432s1c1
Sequence:CCGGCAATGTGACTACACTGAGCCTCTCGAGAGGCTCAGTGTAGTCACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-1426s1c1
Sequence:CCGGGAGGACAATGTGGTCATCATCCTCGAGGATGATGACCACATTGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-1431s1c1
Sequence:CCGGCAATGTGGTCATCATCTACCTCTCGAGAGGTAGATGATGACCACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-600s1c1
Sequence:CCGGCCACAATCTCATCTCTGACTTCTCGAGAAGTCAGAGATGAGATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005545.3-1687s1c1
Sequence:CCGGCCTCTCCTTCTAATCTCTTCTCTCGAGAGAAGAGATTAGAAGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005545
ISLR MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily containing leucine-rich repeat
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-432s1c1
Sequence:CCGGCAATGTGACTACACTGAGCCTCTCGAGAGGCTCAGTGTAGTCACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-1426s1c1
Sequence:CCGGGAGGACAATGTGGTCATCATCCTCGAGGATGATGACCACATTGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-1431s1c1
Sequence:CCGGCAATGTGGTCATCATCTACCTCTCGAGAGGTAGATGATGACCACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-600s1c1
Sequence:CCGGCCACAATCTCATCTCTGACTTCTCGAGAAGTCAGAGATGAGATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005545.3-1687s1c1
Sequence:CCGGCCTCTCCTTCTAATCTCTTCTCTCGAGAGAAGAGATTAGAAGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005545
ISLR MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily containing leucine-rich repeat
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-432s1c1
Sequence:CCGGCAATGTGACTACACTGAGCCTCTCGAGAGGCTCAGTGTAGTCACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-1426s1c1
Sequence:CCGGGAGGACAATGTGGTCATCATCCTCGAGGATGATGACCACATTGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-1431s1c1
Sequence:CCGGCAATGTGGTCATCATCTACCTCTCGAGAGGTAGATGATGACCACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005545.3-600s1c1
Sequence:CCGGCCACAATCTCATCTCTGACTTCTCGAGAAGTCAGAGATGAGATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005545.3-1687s1c1
Sequence:CCGGCCTCTCCTTCTAATCTCTTCTCTCGAGAGAAGAGATTAGAAGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012043
ISLR MISSION shRNA Bacterial Glycerol Stock
immunoglobulin superfamily containing leucine-rich repeat
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012043.2-1540s1c1
Sequence:CCGGCCTGCCAATGTTCCGTCTTAACTCGAGTTAAGACGGAACATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-708s1c1
Sequence:CCGGCCACTTGCAGATCAATGACAACTCGAGTTGTCATTGATCTGCAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1192s1c1
Sequence:CCGGAGTGCCGAAAGCTCTGTAAATCTCGAGATTTACAGAGCTTTCGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1408s1c1
Sequence:CCGGGCGCAGCAGTTCTCTGGCATACTCGAGTATGCCAGAGAACTGCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1191s1c1
Sequence:CCGGCAGTGCCGAAAGCTCTGTAAACTCGAGTTTACAGAGCTTTCGGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012043
ISLR MISSION shRNA shRNA Plasmid DNA
immunoglobulin superfamily containing leucine-rich repeat
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012043.2-1540s1c1
Sequence:CCGGCCTGCCAATGTTCCGTCTTAACTCGAGTTAAGACGGAACATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-708s1c1
Sequence:CCGGCCACTTGCAGATCAATGACAACTCGAGTTGTCATTGATCTGCAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1192s1c1
Sequence:CCGGAGTGCCGAAAGCTCTGTAAATCTCGAGATTTACAGAGCTTTCGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1408s1c1
Sequence:CCGGGCGCAGCAGTTCTCTGGCATACTCGAGTATGCCAGAGAACTGCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1191s1c1
Sequence:CCGGCAGTGCCGAAAGCTCTGTAAACTCGAGTTTACAGAGCTTTCGGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012043
ISLR MISSION shRNA Lentiviral Transduction Particles
immunoglobulin superfamily containing leucine-rich repeat
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099855    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012043.2-1540s1c1
Sequence:CCGGCCTGCCAATGTTCCGTCTTAACTCGAGTTAAGACGGAACATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-708s1c1
Sequence:CCGGCCACTTGCAGATCAATGACAACTCGAGTTGTCATTGATCTGCAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1192s1c1
Sequence:CCGGAGTGCCGAAAGCTCTGTAAATCTCGAGATTTACAGAGCTTTCGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1408s1c1
Sequence:CCGGGCGCAGCAGTTCTCTGGCATACTCGAGTATGCCAGAGAACTGCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012043.2-1191s1c1
Sequence:CCGGCAGTGCCGAAAGCTCTGTAAACTCGAGTTTACAGAGCTTTCGGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)