EMAIL THIS PAGE TO A FRIEND

ISM1

isthmin 1, angiogenesis inhibitor

62 Gene Product Result for
Synonyms: C20orf82 ISM Isthmin bA149I18.1 dJ1077I2.1
UniProtKB ID: B1AKI9, Q8WVH9
Gene ID:
Mouse(319909) isthmin 1 homolog (zebrafish)
Rat(311760) isthmin 1, angiogenesis inhibitor
Zebrafish(497617) isthmin 1
cow(506902) isthmin 1 homolog (zebrafish)
Horse(100063293) isthmin 1 homolog (zebrafish)
domestic cat(101095487) isthmin 1 homolog (zebrafish)
dog(485765) isthmin 1 homolog (zebrafish)
chicken(416740) isthmin 1 homolog (zebrafish)
sheep(101105349) isthmin 1 homolog (zebrafish)
domestic guinea pig(100718146) isthmin 1, angiogenesis inhibitor
naked mole-rat(101703200) isthmin 1, angiogenesis inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_283765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080826 Rosetta Predictions human pricing
XM_097736 Rosetta Predictions human pricing
NM_001134552 Rosetta Predictions rat pricing
NM_001126490 Rosetta Predictions mouse pricing
XM_283765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362602 predicted 309
2 SASI_Hs02_00362603 predicted 1514
3 SASI_Hs02_00362604 predicted 846
4 SASI_Hs02_00362605 predicted 276
5 SASI_Hs02_00362606 predicted 1015
6 SASI_Hs02_00362607 predicted 1482
7 SASI_Hs02_00362608 predicted 534
8 SASI_Hs02_00362609 predicted 367
9 SASI_Hs02_00362610 predicted 336
10 SASI_Hs02_00362611 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_097736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292813 predicted 861
2 SASI_Hs01_00292814 predicted 2072
3 SASI_Hs01_00292815 predicted 1409
4 SASI_Hs01_00292816 predicted 1332
5 SASI_Hs01_00292817 predicted 832
6 SASI_Hs01_00292818 predicted 1574
7 SASI_Hs01_00292819 predicted 2042
8 SASI_Hs01_00292820 predicted 1090
9 SASI_Hs01_00292821 predicted 923
10 SASI_Hs01_00292822 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257009 predicted 2350
2 SASI_Rn02_00257010 predicted 2361
3 SASI_Rn02_00257011 predicted 2977
4 SASI_Rn02_00257012 predicted 2320
5 SASI_Rn02_00257013 predicted 2853
6 SASI_Rn02_00257014 predicted 2576
7 SASI_Rn02_00257015 predicted 1758
8 SASI_Rn02_00257016 predicted 1874
9 SASI_Rn02_00257017 predicted 2285
10 SASI_Rn02_00257018 predicted 2280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126490 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310091 predicted 1314
2 SASI_Mm02_00310092 predicted 1176
3 SASI_Mm02_00310093 predicted 1712
4 SASI_Mm02_00310094 predicted 1526
5 SASI_Mm02_00310095 predicted 760
6 SASI_Mm02_00310096 predicted 1803
7 SASI_Mm02_00310097 predicted 1166
8 SASI_Mm02_00310098 predicted 1275
9 SASI_Mm02_00310099 predicted 1938
10 SASI_Mm02_00310100 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232252 predicted 2543
2 SASI_Mm01_00232253 predicted 2405
3 SASI_Mm01_00232254 predicted 2887
4 SASI_Mm01_00232255 predicted 2930
5 SASI_Mm01_00232256 predicted 2753
6 SASI_Mm01_00232257 predicted 1982
7 SASI_Mm01_00232258 predicted 3027
8 SASI_Mm01_00232259 predicted 2388
9 SASI_Mm01_00232260 predicted 2492
10 SASI_Mm01_00232261 predicted 3162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080826
ISM1 MISSION shRNA Bacterial Glycerol Stock
isthmin 1, angiogenesis inhibitor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-1288s21c1
Sequence:CCGGGGTGACTGGAGCAGGTATAACCTCGAGGTTATACCTGCTCCAGTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-1381s21c1
Sequence:CCGGCAAGAGGCCAGGGAATATTAACTCGAGTTAATATTCCCTGGCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080826.1-1487s21c1
Sequence:CCGGTCATAGCTGCGGTCGTGTATACTCGAGTATACACGACCGCAGCTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-327s21c1
Sequence:CCGGACCAAACTTTCCAGATCTTTCCTCGAGGAAAGATCTGGAAAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-839s21c1
Sequence:CCGGTTGCGGGAAGCGAGGAGTTTACTCGAGTAAACTCCTCGCTTCCCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080826
ISM1 MISSION shRNA shRNA Plasmid DNA
isthmin 1, angiogenesis inhibitor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-1288s21c1
Sequence:CCGGGGTGACTGGAGCAGGTATAACCTCGAGGTTATACCTGCTCCAGTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-1381s21c1
Sequence:CCGGCAAGAGGCCAGGGAATATTAACTCGAGTTAATATTCCCTGGCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080826.1-1487s21c1
Sequence:CCGGTCATAGCTGCGGTCGTGTATACTCGAGTATACACGACCGCAGCTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-327s21c1
Sequence:CCGGACCAAACTTTCCAGATCTTTCCTCGAGGAAAGATCTGGAAAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-839s21c1
Sequence:CCGGTTGCGGGAAGCGAGGAGTTTACTCGAGTAAACTCCTCGCTTCCCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080826
ISM1 MISSION shRNA Lentiviral Transduction Particles
isthmin 1, angiogenesis inhibitor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-1288s21c1
Sequence:CCGGGGTGACTGGAGCAGGTATAACCTCGAGGTTATACCTGCTCCAGTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-1381s21c1
Sequence:CCGGCAAGAGGCCAGGGAATATTAACTCGAGTTAATATTCCCTGGCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080826.1-1487s21c1
Sequence:CCGGTCATAGCTGCGGTCGTGTATACTCGAGTATACACGACCGCAGCTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-327s21c1
Sequence:CCGGACCAAACTTTCCAGATCTTTCCTCGAGGAAAGATCTGGAAAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080826.1-839s21c1
Sequence:CCGGTTGCGGGAAGCGAGGAGTTTACTCGAGTAAACTCCTCGCTTCCCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283765
ISM1 MISSION shRNA Bacterial Glycerol Stock
isthmin 1, angiogenesis inhibitor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1265s1c1
Sequence:CCGGGCCCAGGAATTGAAGATACTTCTCGAGAAGTATCTTCAATTCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283765.2-2471s1c1
Sequence:CCGGGCAGAGTCAAATCTAAGACATCTCGAGATGTCTTAGATTTGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1318s1c1
Sequence:CCGGGCGGGAAGTGAGGAGTTTAATCTCGAGATTAAACTCCTCACTTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1266s1c1
Sequence:CCGGCCCAGGAATTGAAGATACTTTCTCGAGAAAGTATCTTCAATTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-850s1c1
Sequence:CCGGCCAAACATTCAGGTCACCATACTCGAGTATGGTGACCTGAATGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283765
ISM1 MISSION shRNA shRNA Plasmid DNA
isthmin 1, angiogenesis inhibitor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1265s1c1
Sequence:CCGGGCCCAGGAATTGAAGATACTTCTCGAGAAGTATCTTCAATTCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283765.2-2471s1c1
Sequence:CCGGGCAGAGTCAAATCTAAGACATCTCGAGATGTCTTAGATTTGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1318s1c1
Sequence:CCGGGCGGGAAGTGAGGAGTTTAATCTCGAGATTAAACTCCTCACTTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1266s1c1
Sequence:CCGGCCCAGGAATTGAAGATACTTTCTCGAGAAAGTATCTTCAATTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-850s1c1
Sequence:CCGGCCAAACATTCAGGTCACCATACTCGAGTATGGTGACCTGAATGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283765
ISM1 MISSION shRNA Lentiviral Transduction Particles
isthmin 1, angiogenesis inhibitor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1265s1c1
Sequence:CCGGGCCCAGGAATTGAAGATACTTCTCGAGAAGTATCTTCAATTCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_283765.2-2471s1c1
Sequence:CCGGGCAGAGTCAAATCTAAGACATCTCGAGATGTCTTAGATTTGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1318s1c1
Sequence:CCGGGCGGGAAGTGAGGAGTTTAATCTCGAGATTAAACTCCTCACTTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-1266s1c1
Sequence:CCGGCCCAGGAATTGAAGATACTTTCTCGAGAAAGTATCTTCAATTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283765.2-850s1c1
Sequence:CCGGCCAAACATTCAGGTCACCATACTCGAGTATGGTGACCTGAATGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)