EMAIL THIS PAGE TO A FRIEND

ISM2

isthmin 2

122 Gene Product Result for
Synonyms: TAIL1 THSD3
Gene ID:
Human(145501) Summary: The protein encoded by this gene contains a type 1 thrombospondin domain, which is present in thrombospondin, a number of proteins involved in the complement pathway, as well as in extracellular matrix proteins. Two alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Mar 2009]
Mouse(217738) isthmin 2 homolog (zebrafish)
Rat(681936) isthmin 2
Zebrafish(553163) isthmin 2
chicken(428897) isthmin 2 homolog (zebrafish)
domestic cat(101086573) isthmin 2 homolog (zebrafish)
cow(783302) isthmin 2 homolog (zebrafish)
dog(612047) isthmin 2 homolog (zebrafish)
sheep(101111103) isthmin 2 homolog (zebrafish)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182509 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061091 MISSION® esiRNA esiRNA human THSD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182509 Rosetta Predictions human pricing
NM_199265 Rosetta Predictions human pricing
NM_199296 Rosetta Predictions human pricing
XM_001059035 Rosetta Predictions rat pricing
XM_138107 Rosetta Predictions mouse pricing
XM_907185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129596 predicted 904
2 SASI_Hs01_00129597 predicted 895
3 SASI_Hs02_00370583 predicted 900
4 SASI_Hs01_00129599 predicted 851
5 SASI_Hs01_00129600 predicted 1221
6 SASI_Hs01_00129601 predicted 851
7 SASI_Hs02_00370584 predicted 854
8 SASI_Hs01_00129598 predicted 898
9 SASI_Hs01_00129604 predicted 364
10 SASI_Hs01_00129602 predicted 867
11 SASI_Hs01_00129603 predicted 400
12 SASI_Hs01_00129605 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053965 predicted 1360
2 SASI_Hs01_00053966 predicted 2016
3 SASI_Hs01_00053967 predicted 1345
4 SASI_Hs01_00053968 predicted 1348
5 SASI_Hs01_00053969 predicted 1354
6 SASI_Hs01_00053970 predicted 1305
7 SASI_Hs01_00053971 predicted 1680
8 SASI_Hs01_00053972 predicted 1296
9 SASI_Hs01_00053973 predicted 1302
10 SASI_Hs02_00372692 predicted 2244
11 SASI_Hs01_00053974 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160788 predicted 1249
2 SASI_Hs01_00160789 predicted 1912
3 SASI_Hs01_00160790 predicted 1241
4 SASI_Hs01_00160791 predicted 1249
5 SASI_Hs01_00160792 predicted 1250
6 SASI_Hs01_00160793 predicted 1195
7 SASI_Hs01_00160794 predicted 1575
8 SASI_Hs01_00160795 predicted 1193
9 SASI_Hs01_00160796 predicted 1195
10 SASI_Hs02_00372722 predicted 2136
11 SASI_Hs01_00160797 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291688 predicted 716
2 SASI_Rn02_00291689 predicted 933
3 SASI_Rn02_00291690 predicted 718
4 SASI_Rn02_00291691 predicted 341
5 SASI_Rn02_00291692 predicted 886
6 SASI_Rn02_00291693 predicted 632
7 SASI_Rn02_00291694 predicted 861
8 SASI_Rn02_00291695 predicted 315
9 SASI_Rn02_00291696 predicted 406
10 SASI_Rn02_00291697 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279392 predicted 938
2 SASI_Mm01_00279393 predicted 1175
3 SASI_Mm01_00279394 predicted 984
4 SASI_Mm01_00279395 predicted 1086
5 SASI_Mm01_00279396 predicted 1119
6 SASI_Mm01_00279397 predicted 875
7 SASI_Mm01_00279398 predicted 916
8 SASI_Mm01_00279399 predicted 1134
9 SASI_Mm01_00279400 predicted 1201
10 SASI_Mm01_00279401 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433119 predicted 978
2 SASI_Mm02_00433120 predicted 407
3 SASI_Mm02_00433121 predicted 1087
4 SASI_Mm02_00433122 predicted 1125
5 SASI_Mm02_00433123 predicted 603
6 SASI_Mm02_00433124 predicted 1088
7 SASI_Mm02_00433125 predicted 1138
8 SASI_Mm02_00433126 predicted 756
9 SASI_Mm02_00433127 predicted 1197
10 SASI_Mm02_00433128 predicted 1202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182509
ISM2 MISSION shRNA Bacterial Glycerol Stock
isthmin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182509.3-642s21c1
Sequence:CCGGCTGCAGAAGCTGCCAGAATTGCTCGAGCAATTCTGGCAGCTTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182509.2-2101s1c1
Sequence:CCGGCCCTCTGTTCTGCTGATTGTACTCGAGTACAATCAGCAGAACAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-854s1c1
Sequence:CCGGGCTACGGACATGCATGATCAACTCGAGTTGATCATGCATGTCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-494s1c1
Sequence:CCGGCCAACATGGATGTTGGACTGTCTCGAGACAGTCCAACATCCATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-634s1c1
Sequence:CCGGCTAACCCTGATAACCAGACTACTCGAGTAGTCTGGTTATCAGGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-484s1c1
Sequence:CCGGCAGAGCTACACCAACATGGATCTCGAGATCCATGTTGGTGTAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182509.3-1268s21c1
Sequence:CCGGAGCACCGACTTCTCACCTAAGCTCGAGCTTAGGTGAGAAGTCGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182509.3-955s21c1
Sequence:CCGGCTGCAAGAGCGACTTCCTAATCTCGAGATTAGGAAGTCGCTCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182509
ISM2 MISSION shRNA shRNA Plasmid DNA
isthmin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182509.3-642s21c1
Sequence:CCGGCTGCAGAAGCTGCCAGAATTGCTCGAGCAATTCTGGCAGCTTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182509.2-2101s1c1
Sequence:CCGGCCCTCTGTTCTGCTGATTGTACTCGAGTACAATCAGCAGAACAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-854s1c1
Sequence:CCGGGCTACGGACATGCATGATCAACTCGAGTTGATCATGCATGTCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-494s1c1
Sequence:CCGGCCAACATGGATGTTGGACTGTCTCGAGACAGTCCAACATCCATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-634s1c1
Sequence:CCGGCTAACCCTGATAACCAGACTACTCGAGTAGTCTGGTTATCAGGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-484s1c1
Sequence:CCGGCAGAGCTACACCAACATGGATCTCGAGATCCATGTTGGTGTAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182509.3-1268s21c1
Sequence:CCGGAGCACCGACTTCTCACCTAAGCTCGAGCTTAGGTGAGAAGTCGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182509.3-955s21c1
Sequence:CCGGCTGCAAGAGCGACTTCCTAATCTCGAGATTAGGAAGTCGCTCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182509
ISM2 MISSION shRNA Lentiviral Transduction Particles
isthmin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182509.3-642s21c1
Sequence:CCGGCTGCAGAAGCTGCCAGAATTGCTCGAGCAATTCTGGCAGCTTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182509.2-2101s1c1
Sequence:CCGGCCCTCTGTTCTGCTGATTGTACTCGAGTACAATCAGCAGAACAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-854s1c1
Sequence:CCGGGCTACGGACATGCATGATCAACTCGAGTTGATCATGCATGTCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-494s1c1
Sequence:CCGGCCAACATGGATGTTGGACTGTCTCGAGACAGTCCAACATCCATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-634s1c1
Sequence:CCGGCTAACCCTGATAACCAGACTACTCGAGTAGTCTGGTTATCAGGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182509.2-484s1c1
Sequence:CCGGCAGAGCTACACCAACATGGATCTCGAGATCCATGTTGGTGTAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373766    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182509.3-1268s21c1
Sequence:CCGGAGCACCGACTTCTCACCTAAGCTCGAGCTTAGGTGAGAAGTCGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182509.3-955s21c1
Sequence:CCGGCTGCAAGAGCGACTTCCTAATCTCGAGATTAGGAAGTCGCTCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)