EMAIL THIS PAGE TO A FRIEND

ISOC2

isochorismatase domain containing 2

48 Gene Product Result for
UniProtKB ID: Q96AB3, Q6ZN91, Q9H5G0
Gene ID:
domestic guinea pig(100735534) isochorismatase domain containing 2
naked mole-rat(101703349) isochorismatase domain containing 2
Zebrafish(492617) isochorismatase domain containing 2
dog(609103) isochorismatase domain containing 2
cow(516212) isochorismatase domain containing 2
domestic cat(101084149) isochorismatase domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024710 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121481 MISSION® esiRNA esiRNA human ISOC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024710 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079170 predicted 678
2 SASI_Hs01_00079171 predicted 238
3 SASI_Hs01_00079172 predicted 203
4 SASI_Hs01_00079173 predicted 631
5 SASI_Hs01_00079174 predicted 216
6 SASI_Hs01_00079175 predicted 208
7 SASI_Hs01_00079176 predicted 514
8 SASI_Hs01_00079177 predicted 662
9 SASI_Hs01_00079178 predicted 227
10 SASI_Hs01_00079179 predicted 282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024710
VALIDATED
ISOC2 MISSION shRNA Bacterial Glycerol Stock
isochorismatase domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024710.1-964s1c1
Sequence:CCGGCCCGGAAATGCAAATGAGACTCTCGAGAGTCTCATTTGCATTTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-197s1c1
Sequence:CCGGGTGTGACATGCAGGAGAAGTTCTCGAGAACTTCTCCTGCATGTCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-722s1c1
Sequence:CCGGGATCCAGAAACTCATCAAGGACTCGAGTCCTTGATGAGTTTCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-716s1c1
Sequence:CCGGCAAGGAGATCCAGAAACTCATCTCGAGATGAGTTTCTGGATCTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-235s21c1
Sequence:CCGGACTTCCCACAGATCGTCTCAGCTCGAGCTGAGACGATCTGTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-446s21c1
Sequence:CCGGTGTGCTGCTCTGTGGCATTGACTCGAGTCAATGCCACAGAGCAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024710.1-720s21c1
Sequence:CCGGGAGATCCAGAAACTCATCAAGCTCGAGCTTGATGAGTTTCTGGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024710.1-208s21c1
Sequence:CCGGAGGAGAAGTTCCGCCACAACACTCGAGTGTTGTGGCGGAACTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-958s21c1
Sequence:CCGGGCTGCTCCCGGAAATGCAAATCTCGAGATTTGCATTTCCGGGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024710
VALIDATED
ISOC2 MISSION shRNA shRNA Plasmid DNA
isochorismatase domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024710.1-964s1c1
Sequence:CCGGCCCGGAAATGCAAATGAGACTCTCGAGAGTCTCATTTGCATTTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-197s1c1
Sequence:CCGGGTGTGACATGCAGGAGAAGTTCTCGAGAACTTCTCCTGCATGTCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-722s1c1
Sequence:CCGGGATCCAGAAACTCATCAAGGACTCGAGTCCTTGATGAGTTTCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-716s1c1
Sequence:CCGGCAAGGAGATCCAGAAACTCATCTCGAGATGAGTTTCTGGATCTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-235s21c1
Sequence:CCGGACTTCCCACAGATCGTCTCAGCTCGAGCTGAGACGATCTGTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-446s21c1
Sequence:CCGGTGTGCTGCTCTGTGGCATTGACTCGAGTCAATGCCACAGAGCAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024710.1-720s21c1
Sequence:CCGGGAGATCCAGAAACTCATCAAGCTCGAGCTTGATGAGTTTCTGGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024710.1-208s21c1
Sequence:CCGGAGGAGAAGTTCCGCCACAACACTCGAGTGTTGTGGCGGAACTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-958s21c1
Sequence:CCGGGCTGCTCCCGGAAATGCAAATCTCGAGATTTGCATTTCCGGGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024710
VALIDATED
ISOC2 MISSION shRNA Lentiviral Transduction Particles
isochorismatase domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184702    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024710.1-964s1c1
Sequence:CCGGCCCGGAAATGCAAATGAGACTCTCGAGAGTCTCATTTGCATTTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-197s1c1
Sequence:CCGGGTGTGACATGCAGGAGAAGTTCTCGAGAACTTCTCCTGCATGTCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-722s1c1
Sequence:CCGGGATCCAGAAACTCATCAAGGACTCGAGTCCTTGATGAGTTTCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024710.1-716s1c1
Sequence:CCGGCAAGGAGATCCAGAAACTCATCTCGAGATGAGTTTCTGGATCTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-235s21c1
Sequence:CCGGACTTCCCACAGATCGTCTCAGCTCGAGCTGAGACGATCTGTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-446s21c1
Sequence:CCGGTGTGCTGCTCTGTGGCATTGACTCGAGTCAATGCCACAGAGCAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024710.1-720s21c1
Sequence:CCGGGAGATCCAGAAACTCATCAAGCTCGAGCTTGATGAGTTTCTGGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024710.1-208s21c1
Sequence:CCGGAGGAGAAGTTCCGCCACAACACTCGAGTGTTGTGGCGGAACTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_024710.1-958s21c1
Sequence:CCGGGCTGCTCCCGGAAATGCAAATCTCGAGATTTGCATTTCCGGGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)