EMAIL THIS PAGE TO A FRIEND

ISPD

isoprenoid synthase domain containing

62 Gene Product Result for
Synonyms: MDDGA7 Nip
UniProtKB ID: A4D126, A8MU35, H9KVB2
Gene ID:
Human(729920) Summary: This gene encodes a 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein. Mutations in this gene are the cause of Walker-Warburg syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(75847) isoprenoid synthase domain containing
Rat(493574) isoprenoid synthase domain containing
Zebrafish(798716) isoprenoid synthase domain containing
Thale Cress(814779) 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
Horse(100065851) isoprenoid synthase domain containing
cow(100337328) isoprenoid synthase domain containing
dog(100687645) isoprenoid synthase domain containing
chicken(420591) isoprenoid synthase domain containing
domestic guinea pig(100714480) isoprenoid synthase domain containing
naked mole-rat(101708024) isoprenoid synthase domain containing
sheep(101117925) isoprenoid synthase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001101417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101417 Rosetta Predictions human pricing
NM_001101426 Rosetta Predictions human pricing
NM_001008386 Rosetta Predictions rat pricing
NM_178629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322829 predicted 248
2 SASI_Hs02_00322830 predicted 235
3 SASI_Hs02_00322831 predicted 264
4 SASI_Hs02_00322832 predicted 901
5 SASI_Hs02_00322833 predicted 818
6 SASI_Hs02_00322834 predicted 297
7 SASI_Hs02_00322835 predicted 295
8 SASI_Hs02_00322836 predicted 247
9 SASI_Hs02_00322837 predicted 913
10 SASI_Hs02_00322838 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322849 predicted 249
2 SASI_Hs02_00322850 predicted 234
3 SASI_Hs02_00322851 predicted 271
4 SASI_Hs02_00322852 predicted 1050
5 SASI_Hs02_00322853 predicted 965
6 SASI_Hs02_00322854 predicted 296
7 SASI_Hs02_00322855 predicted 294
8 SASI_Hs02_00322856 predicted 246
9 SASI_Hs02_00322857 predicted 1057
10 SASI_Hs02_00322858 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095981 predicted 1134
2 SASI_Rn01_00095982 predicted 1335
3 SASI_Rn01_00095983 predicted 1345
4 SASI_Rn02_00199166 predicted 526
5 SASI_Rn01_00095984 predicted 757
6 SASI_Rn01_00095985 predicted 333
7 SASI_Rn01_00095986 predicted 1118
8 SASI_Rn01_00095987 predicted 432
9 SASI_Rn01_00095988 predicted 207
10 SASI_Rn01_00095989 predicted 1510
11 SASI_Rn01_00095980 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348990 predicted 1535
2 SASI_Mm01_00081908 predicted 858
3 SASI_Mm02_00348991 predicted 1189
4 SASI_Mm02_00348992 predicted 1157
5 SASI_Mm02_00348993 predicted 1299
6 SASI_Mm01_00081909 predicted 561
7 SASI_Mm02_00348994 predicted 1209
8 SASI_Mm01_00081910 predicted 915
9 SASI_Mm01_00081912 predicted 500
10 SASI_Mm01_00081914 predicted 694
11 SASI_Mm01_00081907 predicted 1196
12 SASI_Mm01_00081911 predicted 864
13 SASI_Mm01_00081913 predicted 1194
14 SASI_Mm01_00081915 predicted 1103
15 SASI_Mm01_00081916 predicted 1106
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178629
ISPD MISSION shRNA Bacterial Glycerol Stock
isoprenoid synthase domain containing
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178629.2-2212s1c1
Sequence:CCGGGCCAGCACATACTAGACACTACTCGAGTAGTGTCTAGTATGTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-861s1c1
Sequence:CCGGGTATCAGCAGTGTAGTGATTTCTCGAGAAATCACTACACTGCTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-609s1c1
Sequence:CCGGGCCAGACTGTAAACTCACTAACTCGAGTTAGTGAGTTTACAGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-501s1c1
Sequence:CCGGGAGAAGTATCATCCAGAGGTACTCGAGTACCTCTGGATGATACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178629
ISPD MISSION shRNA shRNA Plasmid DNA
isoprenoid synthase domain containing
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178629.2-2212s1c1
Sequence:CCGGGCCAGCACATACTAGACACTACTCGAGTAGTGTCTAGTATGTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-861s1c1
Sequence:CCGGGTATCAGCAGTGTAGTGATTTCTCGAGAAATCACTACACTGCTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-609s1c1
Sequence:CCGGGCCAGACTGTAAACTCACTAACTCGAGTTAGTGAGTTTACAGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-501s1c1
Sequence:CCGGGAGAAGTATCATCCAGAGGTACTCGAGTACCTCTGGATGATACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178629
ISPD MISSION shRNA Lentiviral Transduction Particles
isoprenoid synthase domain containing
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178629.2-2212s1c1
Sequence:CCGGGCCAGCACATACTAGACACTACTCGAGTAGTGTCTAGTATGTGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-861s1c1
Sequence:CCGGGTATCAGCAGTGTAGTGATTTCTCGAGAAATCACTACACTGCTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-609s1c1
Sequence:CCGGGCCAGACTGTAAACTCACTAACTCGAGTTAGTGAGTTTACAGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178629.2-501s1c1
Sequence:CCGGGAGAAGTATCATCCAGAGGTACTCGAGTACCTCTGGATGATACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101417
ISPD MISSION shRNA Bacterial Glycerol Stock
isoprenoid synthase domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-1127s21c1
Sequence:CCGGTAAGGCAAGGTGCTATCATTACTCGAGTAATGATAGCACCTTGCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-921s21c1
Sequence:CCGGGCTTGAAGAGAGTAGTCTTTGCTCGAGCAAAGACTACTCTCTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-661s21c1
Sequence:CCGGTATGCGGCTGAATCGATTATTCTCGAGAATAATCGATTCAGCCGCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-415s21c1
Sequence:CCGGGAAGATCAGATCAACTCTAAACTCGAGTTTAGAGTTGATCTGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-842s21c1
Sequence:CCGGTCTTAGATCAATGCTACAATTCTCGAGAATTGTAGCATTGATCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101417
ISPD MISSION shRNA shRNA Plasmid DNA
isoprenoid synthase domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-1127s21c1
Sequence:CCGGTAAGGCAAGGTGCTATCATTACTCGAGTAATGATAGCACCTTGCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-921s21c1
Sequence:CCGGGCTTGAAGAGAGTAGTCTTTGCTCGAGCAAAGACTACTCTCTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-661s21c1
Sequence:CCGGTATGCGGCTGAATCGATTATTCTCGAGAATAATCGATTCAGCCGCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-415s21c1
Sequence:CCGGGAAGATCAGATCAACTCTAAACTCGAGTTTAGAGTTGATCTGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-842s21c1
Sequence:CCGGTCTTAGATCAATGCTACAATTCTCGAGAATTGTAGCATTGATCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101417
ISPD MISSION shRNA Lentiviral Transduction Particles
isoprenoid synthase domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-1127s21c1
Sequence:CCGGTAAGGCAAGGTGCTATCATTACTCGAGTAATGATAGCACCTTGCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-921s21c1
Sequence:CCGGGCTTGAAGAGAGTAGTCTTTGCTCGAGCAAAGACTACTCTCTTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-661s21c1
Sequence:CCGGTATGCGGCTGAATCGATTATTCTCGAGAATAATCGATTCAGCCGCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-415s21c1
Sequence:CCGGGAAGATCAGATCAACTCTAAACTCGAGTTTAGAGTTGATCTGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101417.2-842s21c1
Sequence:CCGGTCTTAGATCAATGCTACAATTCTCGAGAATTGTAGCATTGATCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)