EMAIL THIS PAGE TO A FRIEND

IST1

increased sodium tolerance 1 homolog (yeast)

162 Gene Product Result for
Synonyms: OLC1
UniProtKB ID: P53990, A8KAH5, Q3SYM4, Q9BQ81, Q9BWN2
Gene ID:
Human(9798) Summary: This gene encodes a protein with MIT-interacting motifs that interacts with components of endosomal sorting complexes required for transport (ESCRT). ESCRT functions in vesicle budding, such as that which occurs during membrane abscission in cytokinesis. There is a pseudogene for this gene on chromosome 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Mouse(71955) increased sodium tolerance 1 homolog (yeast)
Rat(307833) increased sodium tolerance 1 homolog (yeast)
Zebrafish(321460) increased sodium tolerance 1 homolog (yeast)
chicken(415877) increased sodium tolerance 1 homolog (yeast)
domestic cat(101100611) increased sodium tolerance 1 homolog (yeast)
dog(479667) increased sodium tolerance 1 homolog (yeast)
cow(508900) increased sodium tolerance 1 homolog (yeast)
sheep(101102921) increased sodium tolerance 1 homolog (yeast)
domestic guinea pig(100732851) increased sodium tolerance 1 homolog (yeast)
naked mole-rat(101703210) increased sodium tolerance 1 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0064 AQUA Peptide TNQIGTVND[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0063 AQUA Peptide LQSEVAEL[K] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014761 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014761 Rosetta Predictions human pricing
NM_001017454 Rosetta Predictions rat pricing
NM_028018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128302 predicted 389
2 SASI_Hs01_00128303 predicted 774
3 SASI_Hs01_00128308 predicted 541
4 SASI_Hs02_00346240 predicted 437
5 SASI_Hs01_00128310 predicted 481
6 SASI_Hs02_00346241 predicted 774
7 SASI_Hs02_00346242 predicted 1202
8 SASI_Hs02_00346243 predicted 644
9 SASI_Hs02_00346244 predicted 658
10 SASI_Hs02_00346245 predicted 810
11 SASI_Hs01_00128301 predicted 918
12 SASI_Hs01_00128304 predicted 555
13 SASI_Hs01_00128305 predicted 1092
14 SASI_Hs01_00128306 predicted 911
15 SASI_Hs01_00128307 predicted 315
16 SASI_Hs01_00128309 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061082 predicted 1224
2 SASI_Rn01_00061083 predicted 350
3 SASI_Rn01_00061084 predicted 492
4 SASI_Rn01_00061085 predicted 1242
5 SASI_Rn01_00061086 predicted 352
6 SASI_Rn01_00061087 predicted 489
7 SASI_Rn01_00061088 predicted 1512
8 SASI_Rn01_00061089 predicted 1406
9 SASI_Rn01_00061090 predicted 1227
10 SASI_Rn01_00061091 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140387 predicted 664
2 SASI_Mm01_00140388 predicted 1224
3 SASI_Mm01_00140389 predicted 1236
4 SASI_Mm01_00140390 predicted 922
5 SASI_Mm01_00140391 predicted 978
6 SASI_Mm01_00140392 predicted 870
7 SASI_Mm01_00140394 predicted 1253
8 SASI_Mm02_00333153 predicted 581
9 SASI_Mm01_00140396 predicted 807
10 SASI_Mm02_00333154 predicted 770
11 SASI_Mm01_00140393 predicted 690
12 SASI_Mm01_00140395 predicted 523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014761
IST1 MISSION shRNA Bacterial Glycerol Stock
increased sodium tolerance 1 homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-853s21c1
Sequence:CCGGATCAGGCCTTTCCCAATATTCCTCGAGGAATATTGGGAAAGGCCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014761.2-1312s21c1
Sequence:CCGGGCTGCTTTCCAGTTCTCTGTTCTCGAGAACAGAGAACTGGAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-809s21c1
Sequence:CCGGGCCAAAGGGACCATCAGATTTCTCGAGAAATCTGATGGTCCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-351s21c1
Sequence:CCGGGCTGAATCTGTGTCTACATTGCTCGAGCAATGTAGACACAGATTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-903s21c1
Sequence:CCGGTCGTATGAATCTATGACATTACTCGAGTAATGTCATAGATTCATACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-1053s1c1
Sequence:CCGGCAGACACACTACCAACTGCATCTCGAGATGCAGTTGGTAGTGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-1115s1c1
Sequence:CCGGGATGATCTTTCCCGGAGGTTTCTCGAGAAACCTCCGGGAAAGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-476s1c1
Sequence:CCGGCAACCAGATTGGAACTGTGAACTCGAGTTCACAGTTCCAATCTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014761.2-1312s1c1
Sequence:CCGGGCTGCTTTCCAGTTCTCTGTTCTCGAGAACAGAGAACTGGAAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014761.2-1201s1c1
Sequence:CCGGCTGAGCAATTTCTCCTTGTAACTCGAGTTACAAGGAGAAATTGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014761
IST1 MISSION shRNA shRNA Plasmid DNA
increased sodium tolerance 1 homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-853s21c1
Sequence:CCGGATCAGGCCTTTCCCAATATTCCTCGAGGAATATTGGGAAAGGCCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014761.2-1312s21c1
Sequence:CCGGGCTGCTTTCCAGTTCTCTGTTCTCGAGAACAGAGAACTGGAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-809s21c1
Sequence:CCGGGCCAAAGGGACCATCAGATTTCTCGAGAAATCTGATGGTCCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-351s21c1
Sequence:CCGGGCTGAATCTGTGTCTACATTGCTCGAGCAATGTAGACACAGATTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-903s21c1
Sequence:CCGGTCGTATGAATCTATGACATTACTCGAGTAATGTCATAGATTCATACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-1053s1c1
Sequence:CCGGCAGACACACTACCAACTGCATCTCGAGATGCAGTTGGTAGTGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-1115s1c1
Sequence:CCGGGATGATCTTTCCCGGAGGTTTCTCGAGAAACCTCCGGGAAAGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-476s1c1
Sequence:CCGGCAACCAGATTGGAACTGTGAACTCGAGTTCACAGTTCCAATCTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014761.2-1312s1c1
Sequence:CCGGGCTGCTTTCCAGTTCTCTGTTCTCGAGAACAGAGAACTGGAAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014761.2-1201s1c1
Sequence:CCGGCTGAGCAATTTCTCCTTGTAACTCGAGTTACAAGGAGAAATTGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014761
IST1 MISSION shRNA Lentiviral Transduction Particles
increased sodium tolerance 1 homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-853s21c1
Sequence:CCGGATCAGGCCTTTCCCAATATTCCTCGAGGAATATTGGGAAAGGCCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014761.2-1312s21c1
Sequence:CCGGGCTGCTTTCCAGTTCTCTGTTCTCGAGAACAGAGAACTGGAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-809s21c1
Sequence:CCGGGCCAAAGGGACCATCAGATTTCTCGAGAAATCTGATGGTCCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-351s21c1
Sequence:CCGGGCTGAATCTGTGTCTACATTGCTCGAGCAATGTAGACACAGATTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014761.2-903s21c1
Sequence:CCGGTCGTATGAATCTATGACATTACTCGAGTAATGTCATAGATTCATACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-1053s1c1
Sequence:CCGGCAGACACACTACCAACTGCATCTCGAGATGCAGTTGGTAGTGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-1115s1c1
Sequence:CCGGGATGATCTTTCCCGGAGGTTTCTCGAGAAACCTCCGGGAAAGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014761.2-476s1c1
Sequence:CCGGCAACCAGATTGGAACTGTGAACTCGAGTTCACAGTTCCAATCTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129426    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014761.2-1312s1c1
Sequence:CCGGGCTGCTTTCCAGTTCTCTGTTCTCGAGAACAGAGAACTGGAAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014761.2-1201s1c1
Sequence:CCGGCTGAGCAATTTCTCCTTGTAACTCGAGTTACAAGGAGAAATTGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028018
VALIDATED
IST1 MISSION shRNA Bacterial Glycerol Stock
increased sodium tolerance 1 homolog (yeast)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028018.1-1555s1c1
Sequence:CCGGGTTTCAACCTTGACTCGTAAACTCGAGTTTACGAGTCAAGGTTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-937s1c1
Sequence:CCGGGAATCTGTTGATGACATTAATCTCGAGATTAATGTCATCAACAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-1023s21c1
Sequence:CCGGTTCCAGACCTGTGGATAATTACTCGAGTAATTATCCACAGGTCTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028018.1-255s21c1
Sequence:CCGGCATCCGTGTGGAGCACATAATCTCGAGATTATGTGCTCCACACGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-1557s21c1
Sequence:CCGGTTCAACCTTGACTCGTAAATACTCGAGTATTTACGAGTCAAGGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-665s21c1
Sequence:CCGGGGGTGGAGACAGATCTTATTGCTCGAGCAATAAGATCTGTCTCCACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-937s21c1
Sequence:CCGGGAATCTGTTGATGACATTAATCTCGAGATTAATGTCATCAACAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-157s1c1
Sequence:CCGGCGTCTCAAACTGTTGGAGAAACTCGAGTTTCTCCAACAGTTTGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-583s1c1
Sequence:CCGGGAGAGATACCTGATTGAAATTCTCGAGAATTTCAATCAGGTATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028018
VALIDATED
IST1 MISSION shRNA shRNA Plasmid DNA
increased sodium tolerance 1 homolog (yeast)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028018.1-1555s1c1
Sequence:CCGGGTTTCAACCTTGACTCGTAAACTCGAGTTTACGAGTCAAGGTTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-937s1c1
Sequence:CCGGGAATCTGTTGATGACATTAATCTCGAGATTAATGTCATCAACAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-1023s21c1
Sequence:CCGGTTCCAGACCTGTGGATAATTACTCGAGTAATTATCCACAGGTCTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028018.1-255s21c1
Sequence:CCGGCATCCGTGTGGAGCACATAATCTCGAGATTATGTGCTCCACACGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-1557s21c1
Sequence:CCGGTTCAACCTTGACTCGTAAATACTCGAGTATTTACGAGTCAAGGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-665s21c1
Sequence:CCGGGGGTGGAGACAGATCTTATTGCTCGAGCAATAAGATCTGTCTCCACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000266801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-937s21c1
Sequence:CCGGGAATCTGTTGATGACATTAATCTCGAGATTAATGTCATCAACAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-157s1c1
Sequence:CCGGCGTCTCAAACTGTTGGAGAAACTCGAGTTTCTCCAACAGTTTGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-583s1c1
Sequence:CCGGGAGAGATACCTGATTGAAATTCTCGAGAATTTCAATCAGGTATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028018
VALIDATED
IST1 MISSION shRNA Lentiviral Transduction Particles
increased sodium tolerance 1 homolog (yeast)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216431    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028018.1-1555s1c1
Sequence:CCGGGTTTCAACCTTGACTCGTAAACTCGAGTTTACGAGTCAAGGTTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-937s1c1
Sequence:CCGGGAATCTGTTGATGACATTAATCTCGAGATTAATGTCATCAACAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-1023s21c1
Sequence:CCGGTTCCAGACCTGTGGATAATTACTCGAGTAATTATCCACAGGTCTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028018.1-255s21c1
Sequence:CCGGCATCCGTGTGGAGCACATAATCTCGAGATTATGTGCTCCACACGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-1557s21c1
Sequence:CCGGTTCAACCTTGACTCGTAAATACTCGAGTATTTACGAGTCAAGGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-665s21c1
Sequence:CCGGGGGTGGAGACAGATCTTATTGCTCGAGCAATAAGATCTGTCTCCACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000266801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028018.1-937s21c1
Sequence:CCGGGAATCTGTTGATGACATTAATCTCGAGATTAATGTCATCAACAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-157s1c1
Sequence:CCGGCGTCTCAAACTGTTGGAGAAACTCGAGTTTCTCCAACAGTTTGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191849    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028018.1-583s1c1
Sequence:CCGGGAGAGATACCTGATTGAAATTCTCGAGAATTTCAATCAGGTATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)