EMAIL THIS PAGE TO A FRIEND

ISX

intestine-specific homeobox

85 Gene Product Result for
Synonyms: Pix-1 RAXLX
UniProtKB ID: Q2M1V0, Q68DJ5
Gene ID:
Human(91464) Summary: Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the RAXLX homeobox gene family. [provided by RefSeq, Jul 2008]
Mouse(71597) intestine specific homeobox
Rat(682968) intestine-specific homeobox
chicken(418060) intestine-specific homeobox
cow(506388) intestine-specific homeobox
domestic cat(101091713) intestine-specific homeobox
dog(610571) intestine-specific homeobox
domestic guinea pig(100714899) intestine-specific homeobox
naked mole-rat(101698075) intestine-specific homeobox
sheep(101103802) intestine-specific homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008494 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008494 Rosetta Predictions human pricing
XM_001063896 Rosetta Predictions rat pricing
NM_027837 Rosetta Predictions mouse pricing
XM_134330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046288 predicted 1712
2 SASI_Hs01_00046289 predicted 1488
3 SASI_Hs01_00046290 predicted 1203
4 SASI_Hs01_00046291 predicted 1233
5 SASI_Hs01_00046292 predicted 1586
6 SASI_Hs01_00046293 predicted 1074
7 SASI_Hs01_00046294 predicted 1045
8 SASI_Hs01_00046295 predicted 1257
9 SASI_Hs01_00046296 predicted 1079
10 SASI_Hs02_00305478 predicted 1314
11 SASI_Hs01_00046297 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308662 predicted 479
2 SASI_Rn02_00308663 predicted 233
3 SASI_Rn02_00308664 predicted 270
4 SASI_Rn02_00308665 predicted 230
5 SASI_Rn02_00308666 predicted 236
6 SASI_Rn02_00308667 predicted 473
7 SASI_Rn02_00308668 predicted 473
8 SASI_Rn02_00308669 predicted 230
9 SASI_Rn02_00308670 predicted 406
10 SASI_Rn02_00308671 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332788 predicted 787
2 SASI_Mm02_00332789 predicted 585
3 SASI_Mm02_00332790 predicted 763
4 SASI_Mm02_00332791 predicted 1023
5 SASI_Mm02_00332792 predicted 765
6 SASI_Mm02_00332793 predicted 1319
7 SASI_Mm02_00332794 predicted 792
8 SASI_Mm02_00332795 predicted 543
9 SASI_Mm02_00332796 predicted 494
10 SASI_Mm02_00332797 predicted 875
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242078 predicted 1249
2 SASI_Mm01_00242079 predicted 1046
3 SASI_Mm01_00242080 predicted 1226
4 SASI_Mm01_00242081 predicted 1484
5 SASI_Mm01_00242082 predicted 1221
6 SASI_Mm01_00242083 predicted 1787
7 SASI_Mm01_00242084 predicted 1248
8 SASI_Mm01_00242085 predicted 1005
9 SASI_Mm01_00242086 predicted 954
10 SASI_Mm01_00242087 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008494
ISX MISSION shRNA Bacterial Glycerol Stock
intestine-specific homeobox
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008494.1-1044s21c1
Sequence:CCGGCTCCATTGAGGCGATCCTAAACTCGAGTTTAGGATCGCCTCAATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008494.1-2048s21c1
Sequence:CCGGGGAGCCAGCTGGATAAGATGACTCGAGTCATCTTATCCAGCTGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008494.1-2148s21c1
Sequence:CCGGCCGTGACACATGAGTACCTACCTCGAGGTAGGTACTCATGTGTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1081s1c1
Sequence:CCGGAGTGATATGGACAGACCAGAACTCGAGTTCTGGTCTGTCCATATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1300s1c1
Sequence:CCGGGCCAGGATCAACCTCCCAGAACTCGAGTTCTGGGAGGTTGATCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1612s1c1
Sequence:CCGGCAAACTTGCATCCCTGTGCTACTCGAGTAGCACAGGGATGCAAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1664s1c1
Sequence:CCGGGCAGCATCTGTGCTACTTCAACTCGAGTTGAAGTAGCACAGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008494.1-1947s1c1
Sequence:CCGGGCTCTGAAATAGGGAGGTAATCTCGAGATTACCTCCCTATTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008494
ISX MISSION shRNA shRNA Plasmid DNA
intestine-specific homeobox
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008494.1-1044s21c1
Sequence:CCGGCTCCATTGAGGCGATCCTAAACTCGAGTTTAGGATCGCCTCAATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008494.1-2048s21c1
Sequence:CCGGGGAGCCAGCTGGATAAGATGACTCGAGTCATCTTATCCAGCTGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008494.1-2148s21c1
Sequence:CCGGCCGTGACACATGAGTACCTACCTCGAGGTAGGTACTCATGTGTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1081s1c1
Sequence:CCGGAGTGATATGGACAGACCAGAACTCGAGTTCTGGTCTGTCCATATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1300s1c1
Sequence:CCGGGCCAGGATCAACCTCCCAGAACTCGAGTTCTGGGAGGTTGATCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1612s1c1
Sequence:CCGGCAAACTTGCATCCCTGTGCTACTCGAGTAGCACAGGGATGCAAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1664s1c1
Sequence:CCGGGCAGCATCTGTGCTACTTCAACTCGAGTTGAAGTAGCACAGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008494.1-1947s1c1
Sequence:CCGGGCTCTGAAATAGGGAGGTAATCTCGAGATTACCTCCCTATTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008494
ISX MISSION shRNA Lentiviral Transduction Particles
intestine-specific homeobox
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008494.1-1044s21c1
Sequence:CCGGCTCCATTGAGGCGATCCTAAACTCGAGTTTAGGATCGCCTCAATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008494.1-2048s21c1
Sequence:CCGGGGAGCCAGCTGGATAAGATGACTCGAGTCATCTTATCCAGCTGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008494.1-2148s21c1
Sequence:CCGGCCGTGACACATGAGTACCTACCTCGAGGTAGGTACTCATGTGTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1081s1c1
Sequence:CCGGAGTGATATGGACAGACCAGAACTCGAGTTCTGGTCTGTCCATATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1300s1c1
Sequence:CCGGGCCAGGATCAACCTCCCAGAACTCGAGTTCTGGGAGGTTGATCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1612s1c1
Sequence:CCGGCAAACTTGCATCCCTGTGCTACTCGAGTAGCACAGGGATGCAAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008494.1-1664s1c1
Sequence:CCGGGCAGCATCTGTGCTACTTCAACTCGAGTTGAAGTAGCACAGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008494.1-1947s1c1
Sequence:CCGGGCTCTGAAATAGGGAGGTAATCTCGAGATTACCTCCCTATTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027837
ISX MISSION shRNA Bacterial Glycerol Stock
intestine-specific homeobox
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-795s21c1
Sequence:CCGGCAATTGGCTTCCAGGATTAACCTCGAGGTTAATCCTGGAAGCCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-752s21c1
Sequence:CCGGGCTCTTCCACTTCACCCATTACTCGAGTAATGGGTGAAGTGGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-1180s21c1
Sequence:CCGGCTTCAACATAGGGACTGATTTCTCGAGAAATCAGTCCCTATGTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-1039s21c1
Sequence:CCGGGCTGGTTCCCTACACAGATTCCTCGAGGAATCTGTGTAGGGAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027837.3-1306s21c1
Sequence:CCGGTACCCAGAGCTTGCCATTAAACTCGAGTTTAATGGCAAGCTCTGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027837
ISX MISSION shRNA shRNA Plasmid DNA
intestine-specific homeobox
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-795s21c1
Sequence:CCGGCAATTGGCTTCCAGGATTAACCTCGAGGTTAATCCTGGAAGCCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-752s21c1
Sequence:CCGGGCTCTTCCACTTCACCCATTACTCGAGTAATGGGTGAAGTGGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-1180s21c1
Sequence:CCGGCTTCAACATAGGGACTGATTTCTCGAGAAATCAGTCCCTATGTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-1039s21c1
Sequence:CCGGGCTGGTTCCCTACACAGATTCCTCGAGGAATCTGTGTAGGGAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027837.3-1306s21c1
Sequence:CCGGTACCCAGAGCTTGCCATTAAACTCGAGTTTAATGGCAAGCTCTGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027837
ISX MISSION shRNA Lentiviral Transduction Particles
intestine-specific homeobox
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-795s21c1
Sequence:CCGGCAATTGGCTTCCAGGATTAACCTCGAGGTTAATCCTGGAAGCCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-752s21c1
Sequence:CCGGGCTCTTCCACTTCACCCATTACTCGAGTAATGGGTGAAGTGGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-1180s21c1
Sequence:CCGGCTTCAACATAGGGACTGATTTCTCGAGAAATCAGTCCCTATGTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027837.3-1039s21c1
Sequence:CCGGGCTGGTTCCCTACACAGATTCCTCGAGGAATCTGTGTAGGGAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027837.3-1306s21c1
Sequence:CCGGTACCCAGAGCTTGCCATTAAACTCGAGTTTAATGGCAAGCTCTGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)