EMAIL THIS PAGE TO A FRIEND

ISY1

ISY1 splicing factor homolog (S. cerevisiae)

46 Gene Product Result for
Synonyms: FSAP33
UniProtKB ID: Q9ULR0, Q96IL2, Q9BT05
Gene ID:
Mouse(57905) ISY1 splicing factor homolog (S. cerevisiae)
Rat(362394) ISY1 splicing factor homolog (S. cerevisiae)
sheep(101106975) ISY1 splicing factor homolog (S. cerevisiae)
domestic guinea pig(100723051) ISY1 splicing factor homolog (S. cerevisiae)
naked mole-rat(101719994) ISY1 splicing factor homolog (S. cerevisiae)
chicken(415968) ISY1 splicing factor homolog (S. cerevisiae)
dog(484629) ISY1 splicing factor homolog (S. cerevisiae)
domestic cat(101084430) ISY1 splicing factor homolog (S. cerevisiae)
cow(783414) ISY1 splicing factor homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020701 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083231 MISSION® esiRNA esiRNA targeting mouse Isy1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020701 Rosetta Predictions human pricing
NM_001014188 Rosetta Predictions rat pricing
NM_133934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227839 predicted 557
2 SASI_Hs01_00227840 predicted 462
3 SASI_Hs01_00227841 predicted 333
4 SASI_Hs01_00227842 predicted 343
5 SASI_Hs01_00227843 predicted 1224
6 SASI_Hs01_00227844 predicted 553
7 SASI_Hs01_00227845 predicted 546
8 SASI_Hs02_00353705 predicted 313
9 SASI_Hs01_00227847 predicted 228
10 SASI_Hs01_00227848 predicted 382
11 SASI_Hs01_00227846 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060125 predicted 422
2 SASI_Rn01_00060126 predicted 400
3 SASI_Rn01_00060127 predicted 292
4 SASI_Rn01_00060128 predicted 390
5 SASI_Rn01_00060129 predicted 420
6 SASI_Rn01_00060130 predicted 253
7 SASI_Rn01_00060131 predicted 196
8 SASI_Rn01_00060132 predicted 420
9 SASI_Rn01_00060133 predicted 327
10 SASI_Rn01_00060134 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162926 predicted 318
2 SASI_Mm01_00162927 predicted 232
3 SASI_Mm01_00162928 predicted 428
4 SASI_Mm01_00162925 predicted 452
5 SASI_Mm01_00162930 predicted 1357
6 SASI_Mm01_00162931 predicted 1195
7 SASI_Mm01_00162934 predicted 1316
8 SASI_Mm02_00339034 predicted 1105
9 SASI_Mm02_00339035 predicted 287
10 SASI_Mm02_00339036 predicted 248
11 SASI_Mm01_00162929 predicted 209
12 SASI_Mm01_00162932 predicted 1197
13 SASI_Mm01_00162933 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133934
ISY1 MISSION shRNA Bacterial Glycerol Stock
ISY1 splicing factor homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-460s1c1
Sequence:CCGGCCCAGGAAATCGAGGTTACAACTCGAGTTGTAACCTCGATTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-506s1c1
Sequence:CCGGCCTGGTGTCAGAGAGCTATTTCTCGAGAAATAGCTCTCTGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133934.2-1108s1c1
Sequence:CCGGCCCTTCAGCTTACCTCCATTTCTCGAGAAATGGAGGTAAGCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-329s1c1
Sequence:CCGGCGGGACCTGAATGACGAAATTCTCGAGAATTTCGTCATTCAGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-907s1c1
Sequence:CCGGGCTCCAGAAATATGCAAGTGACTCGAGTCACTTGCATATTTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-902s21c1
Sequence:CCGGGCTCCAGAAATATGCAAGTGACTCGAGTCACTTGCATATTTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-324s21c1
Sequence:CCGGCGGGACCTGAATGACGAAATTCTCGAGAATTTCGTCATTCAGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133934.4-1103s21c1
Sequence:CCGGCCCTTCAGCTTACCTCCATTTCTCGAGAAATGGAGGTAAGCTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-501s21c1
Sequence:CCGGCCTGGTGTCAGAGAGCTATTTCTCGAGAAATAGCTCTCTGACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133934
ISY1 MISSION shRNA shRNA Plasmid DNA
ISY1 splicing factor homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-460s1c1
Sequence:CCGGCCCAGGAAATCGAGGTTACAACTCGAGTTGTAACCTCGATTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-506s1c1
Sequence:CCGGCCTGGTGTCAGAGAGCTATTTCTCGAGAAATAGCTCTCTGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133934.2-1108s1c1
Sequence:CCGGCCCTTCAGCTTACCTCCATTTCTCGAGAAATGGAGGTAAGCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-329s1c1
Sequence:CCGGCGGGACCTGAATGACGAAATTCTCGAGAATTTCGTCATTCAGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-907s1c1
Sequence:CCGGGCTCCAGAAATATGCAAGTGACTCGAGTCACTTGCATATTTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-902s21c1
Sequence:CCGGGCTCCAGAAATATGCAAGTGACTCGAGTCACTTGCATATTTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-324s21c1
Sequence:CCGGCGGGACCTGAATGACGAAATTCTCGAGAATTTCGTCATTCAGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133934.4-1103s21c1
Sequence:CCGGCCCTTCAGCTTACCTCCATTTCTCGAGAAATGGAGGTAAGCTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-501s21c1
Sequence:CCGGCCTGGTGTCAGAGAGCTATTTCTCGAGAAATAGCTCTCTGACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133934
ISY1 MISSION shRNA Lentiviral Transduction Particles
ISY1 splicing factor homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-460s1c1
Sequence:CCGGCCCAGGAAATCGAGGTTACAACTCGAGTTGTAACCTCGATTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-506s1c1
Sequence:CCGGCCTGGTGTCAGAGAGCTATTTCTCGAGAAATAGCTCTCTGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133934.2-1108s1c1
Sequence:CCGGCCCTTCAGCTTACCTCCATTTCTCGAGAAATGGAGGTAAGCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-329s1c1
Sequence:CCGGCGGGACCTGAATGACGAAATTCTCGAGAATTTCGTCATTCAGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133934.2-907s1c1
Sequence:CCGGGCTCCAGAAATATGCAAGTGACTCGAGTCACTTGCATATTTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-902s21c1
Sequence:CCGGGCTCCAGAAATATGCAAGTGACTCGAGTCACTTGCATATTTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-324s21c1
Sequence:CCGGCGGGACCTGAATGACGAAATTCTCGAGAATTTCGTCATTCAGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133934.4-1103s21c1
Sequence:CCGGCCCTTCAGCTTACCTCCATTTCTCGAGAAATGGAGGTAAGCTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133934.4-501s21c1
Sequence:CCGGCCTGGTGTCAGAGAGCTATTTCTCGAGAAATAGCTCTCTGACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020701
VALIDATED
ISY1 MISSION shRNA Bacterial Glycerol Stock
ISY1 splicing factor homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-386s1c1
Sequence:CCGGCAGATTCAGAATGCTGGTTTACTCGAGTAAACCAGCATTCTGAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-725s1c1
Sequence:CCGGCCTTTGGAACAGGAATATGAACTCGAGTTCATATTCCTGTTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020701.1-1364s1c1
Sequence:CCGGGAAGAATCAATTAGTGGCAAACTCGAGTTTGCCACTAATTGATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-599s1c1
Sequence:CCGGCCTGGTGTTAGAGAGCTGTTTCTCGAGAAACAGCTCTCTAACACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-383s1c1
Sequence:CCGGGCTCAGATTCAGAATGCTGGTCTCGAGACCAGCATTCTGAATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-383s21c1
Sequence:CCGGGCTCAGATTCAGAATGCTGGTCTCGAGACCAGCATTCTGAATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-725s21c1
Sequence:CCGGCCTTTGGAACAGGAATATGAACTCGAGTTCATATTCCTGTTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020701.2-1262s21c1
Sequence:CCGGGCTACTGTGTGGATCCATTTACTCGAGTAAATGGATCCACACAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-561s21c1
Sequence:CCGGACCGAGGTTACAAGTACTTTGCTCGAGCAAAGTACTTGTAACCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020701
VALIDATED
ISY1 MISSION shRNA shRNA Plasmid DNA
ISY1 splicing factor homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-386s1c1
Sequence:CCGGCAGATTCAGAATGCTGGTTTACTCGAGTAAACCAGCATTCTGAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-725s1c1
Sequence:CCGGCCTTTGGAACAGGAATATGAACTCGAGTTCATATTCCTGTTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020701.1-1364s1c1
Sequence:CCGGGAAGAATCAATTAGTGGCAAACTCGAGTTTGCCACTAATTGATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-599s1c1
Sequence:CCGGCCTGGTGTTAGAGAGCTGTTTCTCGAGAAACAGCTCTCTAACACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-383s1c1
Sequence:CCGGGCTCAGATTCAGAATGCTGGTCTCGAGACCAGCATTCTGAATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-383s21c1
Sequence:CCGGGCTCAGATTCAGAATGCTGGTCTCGAGACCAGCATTCTGAATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-725s21c1
Sequence:CCGGCCTTTGGAACAGGAATATGAACTCGAGTTCATATTCCTGTTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020701.2-1262s21c1
Sequence:CCGGGCTACTGTGTGGATCCATTTACTCGAGTAAATGGATCCACACAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-561s21c1
Sequence:CCGGACCGAGGTTACAAGTACTTTGCTCGAGCAAAGTACTTGTAACCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020701
VALIDATED
ISY1 MISSION shRNA Lentiviral Transduction Particles
ISY1 splicing factor homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-386s1c1
Sequence:CCGGCAGATTCAGAATGCTGGTTTACTCGAGTAAACCAGCATTCTGAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-725s1c1
Sequence:CCGGCCTTTGGAACAGGAATATGAACTCGAGTTCATATTCCTGTTCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020701.1-1364s1c1
Sequence:CCGGGAAGAATCAATTAGTGGCAAACTCGAGTTTGCCACTAATTGATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-599s1c1
Sequence:CCGGCCTGGTGTTAGAGAGCTGTTTCTCGAGAAACAGCTCTCTAACACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020701.1-383s1c1
Sequence:CCGGGCTCAGATTCAGAATGCTGGTCTCGAGACCAGCATTCTGAATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-383s21c1
Sequence:CCGGGCTCAGATTCAGAATGCTGGTCTCGAGACCAGCATTCTGAATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-725s21c1
Sequence:CCGGCCTTTGGAACAGGAATATGAACTCGAGTTCATATTCCTGTTCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020701.2-1262s21c1
Sequence:CCGGGCTACTGTGTGGATCCATTTACTCGAGTAAATGGATCCACACAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020701.2-561s21c1
Sequence:CCGGACCGAGGTTACAAGTACTTTGCTCGAGCAAAGTACTTGTAACCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)