EMAIL THIS PAGE TO A FRIEND

ISYNA1

inositol-3-phosphate synthase 1

56 Gene Product Result for
Synonyms: INO1 INOS IPS IPS 1 IPS-1
Gene ID:
Human(51477) Summary: This gene encodes an inositol-3-phosphate synthase enzyme. The encoded protein plays a critical role in the myo-inositol biosynthesis pathway by catalyzing the rate-limiting conversion of glucose 6-phosphate to myoinositol 1-phosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 4. [provided by RefSeq, Nov 2011]
Mouse(71780) myo-inositol 1-phosphate synthase A1
Rat(290651) inositol-3-phosphate synthase 1
dog(476667) inositol-3-phosphate synthase 1
cow(509394) inositol-3-phosphate synthase 1
domestic cat(101087137) inositol-3-phosphate synthase 1
Horse(100069557) inositol-3-phosphate synthase 1
domestic guinea pig(100718292) inositol-3-phosphate synthase 1
naked mole-rat(101723851) inositol-3-phosphate synthase 1
sheep(101109704) inositol-3-phosphate synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016368 Rosetta Predictions human pricing
NM_001013880 Rosetta Predictions rat pricing
NM_023627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055712 predicted 1176
2 SASI_Hs01_00055713 predicted 1096
3 SASI_Hs01_00055714 predicted 1086
4 SASI_Hs01_00055715 predicted 1248
5 SASI_Hs01_00055716 predicted 1156
6 SASI_Hs01_00055717 predicted 764
7 SASI_Hs01_00055718 predicted 1012
8 SASI_Hs01_00055719 predicted 1067
9 SASI_Hs02_00349352 predicted 397
10 SASI_Hs01_00055721 predicted 782
11 SASI_Hs01_00055720 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201150 predicted 1231
2 SASI_Rn02_00201151 predicted 376
3 SASI_Rn02_00201152 predicted 1228
4 SASI_Rn02_00201153 predicted 491
5 SASI_Rn01_00106419 predicted 1299
6 SASI_Rn01_00106420 predicted 871
7 SASI_Rn01_00106421 predicted 1258
8 SASI_Rn02_00201154 predicted 413
9 SASI_Rn01_00106424 predicted 772
10 SASI_Rn02_00201155 predicted 234
11 SASI_Rn01_00106417 predicted 1240
12 SASI_Rn01_00106418 predicted 745
13 SASI_Rn01_00106422 predicted 487
14 SASI_Rn01_00106423 predicted 1231
15 SASI_Rn01_00106425 predicted 1062
16 SASI_Rn01_00106426 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033903 predicted 789
2 SASI_Mm01_00033904 predicted 1193
3 SASI_Mm01_00033905 predicted 389
4 SASI_Mm02_00327237 predicted 1291
5 SASI_Mm01_00033909 predicted 842
6 SASI_Mm02_00327238 predicted 1272
7 SASI_Mm01_00033911 predicted 944
8 SASI_Mm02_00327239 predicted 1230
9 SASI_Mm01_00033912 predicted 1031
10 SASI_Mm02_00327240 predicted 970
11 SASI_Mm01_00033906 predicted 1210
12 SASI_Mm01_00033907 predicted 419
13 SASI_Mm01_00033908 predicted 603
14 SASI_Mm01_00033910 predicted 698
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016368
ISYNA1 MISSION shRNA Bacterial Glycerol Stock
inositol-3-phosphate synthase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-1354s21c1
Sequence:CCGGACTGCGTGGTCATCAAGTATGCTCGAGCATACTTGATGACCACGCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-847s21c1
Sequence:CCGGACATCCGAGACTTCCGGTCTACTCGAGTAGACCGGAAGTCTCGGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-284s1c1
Sequence:CCGGGCTGGCCAATCGACTGCGTTTCTCGAGAAACGCAGTCGATTGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-1144s21c1
Sequence:CCGGCCAAAGTCAAGTCCGTGCTTGCTCGAGCAAGCACGGACTTGACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1320s1c1
Sequence:CCGGGCACCCATCATGCTGGACCTACTCGAGTAGGTCCAGCATGATGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1085s1c1
Sequence:CCGGGCCATTGCAGTTCCGCTCTAACTCGAGTTAGAGCGGAACTGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1622s1c1
Sequence:CCGGCTACCCTATGTTGAACAAGAACTCGAGTTCTTGTTCAACATAGGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1016s1c1
Sequence:CCGGCGGCCTCAAGACCATGTCCATCTCGAGATGGACATGGTCTTGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016368
ISYNA1 MISSION shRNA shRNA Plasmid DNA
inositol-3-phosphate synthase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-1354s21c1
Sequence:CCGGACTGCGTGGTCATCAAGTATGCTCGAGCATACTTGATGACCACGCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-847s21c1
Sequence:CCGGACATCCGAGACTTCCGGTCTACTCGAGTAGACCGGAAGTCTCGGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-284s1c1
Sequence:CCGGGCTGGCCAATCGACTGCGTTTCTCGAGAAACGCAGTCGATTGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-1144s21c1
Sequence:CCGGCCAAAGTCAAGTCCGTGCTTGCTCGAGCAAGCACGGACTTGACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1320s1c1
Sequence:CCGGGCACCCATCATGCTGGACCTACTCGAGTAGGTCCAGCATGATGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1085s1c1
Sequence:CCGGGCCATTGCAGTTCCGCTCTAACTCGAGTTAGAGCGGAACTGCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1622s1c1
Sequence:CCGGCTACCCTATGTTGAACAAGAACTCGAGTTCTTGTTCAACATAGGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1016s1c1
Sequence:CCGGCGGCCTCAAGACCATGTCCATCTCGAGATGGACATGGTCTTGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016368
ISYNA1 MISSION shRNA Lentiviral Transduction Particles
inositol-3-phosphate synthase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-1354s21c1
Sequence:CCGGACTGCGTGGTCATCAAGTATGCTCGAGCATACTTGATGACCACGCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-847s21c1
Sequence:CCGGACATCCGAGACTTCCGGTCTACTCGAGTAGACCGGAAGTCTCGGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-284s1c1
Sequence:CCGGGCTGGCCAATCGACTGCGTTTCTCGAGAAACGCAGTCGATTGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016368.4-1144s21c1
Sequence:CCGGCCAAAGTCAAGTCCGTGCTTGCTCGAGCAAGCACGGACTTGACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1320s1c1
Sequence:CCGGGCACCCATCATGCTGGACCTACTCGAGTAGGTCCAGCATGATGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1085s1c1
Sequence:CCGGGCCATTGCAGTTCCGCTCTAACTCGAGTTAGAGCGGAACTGCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1622s1c1
Sequence:CCGGCTACCCTATGTTGAACAAGAACTCGAGTTCTTGTTCAACATAGGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016368.3-1016s1c1
Sequence:CCGGCGGCCTCAAGACCATGTCCATCTCGAGATGGACATGGTCTTGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023627
ISYNA1 MISSION shRNA Bacterial Glycerol Stock
inositol-3-phosphate synthase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-693s21c1
Sequence:CCGGCCGAAAGGACATTAGAGATTTCTCGAGAAATCTCTAATGTCCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-347s21c1
Sequence:CCGGGTCGCAAGGAGGCAAACTATTCTCGAGAATAGTTTGCCTCCTTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-1518s21c1
Sequence:CCGGGCGCAGCTGTATCGAGAATATCTCGAGATATTCTCGATACAGCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-718s21c1
Sequence:CCGGTCCAGTGCGGGATTGGATAAGCTCGAGCTTATCCAATCCCGCACTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-1205s21c1
Sequence:CCGGACCACTGTGTGGTGATCAAATCTCGAGATTTGATCACCACACAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1049s1c1
Sequence:CCGGCCATGTCCATCGTGAGCTATACTCGAGTATAGCTCACGATGGACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1050s1c1
Sequence:CCGGCATGTCCATCGTGAGCTATAACTCGAGTTATAGCTCACGATGGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1519s1c1
Sequence:CCGGCGCAGCTGTATCGAGAATATTCTCGAGAATATTCTCGATACAGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1572s1c1
Sequence:CCGGCCACATGCTATTAGAGCACAACTCGAGTTGTGCTCTAATAGCATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1518s1c1
Sequence:CCGGGCGCAGCTGTATCGAGAATATCTCGAGATATTCTCGATACAGCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023627
ISYNA1 MISSION shRNA shRNA Plasmid DNA
inositol-3-phosphate synthase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-693s21c1
Sequence:CCGGCCGAAAGGACATTAGAGATTTCTCGAGAAATCTCTAATGTCCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-347s21c1
Sequence:CCGGGTCGCAAGGAGGCAAACTATTCTCGAGAATAGTTTGCCTCCTTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-1518s21c1
Sequence:CCGGGCGCAGCTGTATCGAGAATATCTCGAGATATTCTCGATACAGCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-718s21c1
Sequence:CCGGTCCAGTGCGGGATTGGATAAGCTCGAGCTTATCCAATCCCGCACTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-1205s21c1
Sequence:CCGGACCACTGTGTGGTGATCAAATCTCGAGATTTGATCACCACACAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1049s1c1
Sequence:CCGGCCATGTCCATCGTGAGCTATACTCGAGTATAGCTCACGATGGACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1050s1c1
Sequence:CCGGCATGTCCATCGTGAGCTATAACTCGAGTTATAGCTCACGATGGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1519s1c1
Sequence:CCGGCGCAGCTGTATCGAGAATATTCTCGAGAATATTCTCGATACAGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1572s1c1
Sequence:CCGGCCACATGCTATTAGAGCACAACTCGAGTTGTGCTCTAATAGCATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1518s1c1
Sequence:CCGGGCGCAGCTGTATCGAGAATATCTCGAGATATTCTCGATACAGCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023627
ISYNA1 MISSION shRNA Lentiviral Transduction Particles
inositol-3-phosphate synthase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-693s21c1
Sequence:CCGGCCGAAAGGACATTAGAGATTTCTCGAGAAATCTCTAATGTCCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-347s21c1
Sequence:CCGGGTCGCAAGGAGGCAAACTATTCTCGAGAATAGTTTGCCTCCTTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-1518s21c1
Sequence:CCGGGCGCAGCTGTATCGAGAATATCTCGAGATATTCTCGATACAGCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-718s21c1
Sequence:CCGGTCCAGTGCGGGATTGGATAAGCTCGAGCTTATCCAATCCCGCACTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023627.1-1205s21c1
Sequence:CCGGACCACTGTGTGGTGATCAAATCTCGAGATTTGATCACCACACAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1049s1c1
Sequence:CCGGCCATGTCCATCGTGAGCTATACTCGAGTATAGCTCACGATGGACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1050s1c1
Sequence:CCGGCATGTCCATCGTGAGCTATAACTCGAGTTATAGCTCACGATGGACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1519s1c1
Sequence:CCGGCGCAGCTGTATCGAGAATATTCTCGAGAATATTCTCGATACAGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1572s1c1
Sequence:CCGGCCACATGCTATTAGAGCACAACTCGAGTTGTGCTCTAATAGCATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023627.1-1518s1c1
Sequence:CCGGGCGCAGCTGTATCGAGAATATCTCGAGATATTCTCGATACAGCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)