EMAIL THIS PAGE TO A FRIEND

ITFG1

integrin alpha FG-GAP repeat containing 1

96 Gene Product Result for
Synonyms: TIP
UniProtKB ID: Q8TB96, Q96SR4, Q9BRE2, Q9H2V9
Gene ID:
Mouse(71927) integrin alpha FG-GAP repeat containing 1
Rat(171083) integrin alpha FG-GAP repeat containing 1
Zebrafish(100331534) integrin alpha FG-GAP repeat containing 1
chicken(415742) integrin alpha FG-GAP repeat containing 1
dog(478141) integrin alpha FG-GAP repeat containing 1
Horse(100049976) integrin alpha FG-GAP repeat containing 1
cow(512545) integrin alpha FG-GAP repeat containing 1
domestic cat(101088381) integrin alpha FG-GAP repeat containing 1
domestic guinea pig(100724376) integrin alpha FG-GAP repeat containing 1
naked mole-rat(101700796) integrin alpha FG-GAP repeat containing 1
sheep(101110080) integrin alpha FG-GAP repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030790 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035841 MISSION® esiRNA esiRNA human ITFG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030790 Rosetta Predictions human pricing
NM_133557 Rosetta Predictions rat pricing
XM_579626 Rosetta Predictions rat pricing
NM_028007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058019 predicted 963
2 SASI_Hs01_00058020 predicted 1292
3 SASI_Hs02_00358339 predicted 1727
4 SASI_Hs01_00058021 predicted 1478
5 SASI_Hs01_00058022 predicted 1730
6 SASI_Hs01_00058024 predicted 777
7 SASI_Hs02_00358340 predicted 750
8 SASI_Hs02_00358341 predicted 1387
9 SASI_Hs01_00058026 predicted 1438
10 SASI_Hs02_00358342 predicted 658
11 SASI_Hs01_00058023 predicted 1313
12 SASI_Hs01_00058025 predicted 1311
13 SASI_Hs01_00058027 predicted 1679
14 SASI_Hs01_00058028 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100232 predicted 419
2 SASI_Rn01_00100233 predicted 791
3 SASI_Rn01_00100234 predicted 1375
4 SASI_Rn01_00100236 predicted 1656
5 SASI_Rn01_00100237 predicted 681
6 SASI_Rn01_00100238 predicted 580
7 SASI_Rn01_00100239 predicted 1520
8 SASI_Rn01_00100235 predicted 1360
9 SASI_Rn01_00100240 predicted 1553
10 SASI_Rn02_00267749 predicted 852
11 SASI_Rn01_00100241 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00173777 predicted 296
2 SASI_Rn01_00173778 predicted 227
3 SASI_Rn01_00173779 predicted 248
4 SASI_Rn01_00173780 predicted 203
5 SASI_Rn01_00173781 predicted 305
6 SASI_Rn01_00173782 predicted 363
7 SASI_Rn01_00173783 predicted 346
8 SASI_Rn01_00173784 predicted 285
9 SASI_Rn01_00173785 predicted 666
10 SASI_Rn01_00173786 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113441 predicted 1264
2 SASI_Mm02_00333115 predicted 1355
3 SASI_Mm01_00113442 predicted 464
4 SASI_Mm01_00113443 predicted 1256
5 SASI_Mm01_00113444 predicted 1386
6 SASI_Mm01_00113446 predicted 517
7 SASI_Mm01_00113447 predicted 529
8 SASI_Mm01_00113448 predicted 569
9 SASI_Mm01_00113449 predicted 1633
10 SASI_Mm02_00333116 predicted 989
11 SASI_Mm01_00113440 predicted 1555
12 SASI_Mm01_00113445 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030790
ITFG1 MISSION shRNA Bacterial Glycerol Stock
integrin alpha FG-GAP repeat containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-261s1c1
Sequence:CCGGGCTGCGGGAAAGAAATGACTTCTCGAGAAGTCATTTCTTTCCCGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-1558s1c1
Sequence:CCGGCCATACAACGTGCTTGGTTTACTCGAGTAAACCAAGCACGTTGTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-731s1c1
Sequence:CCGGCGACATTGAATGCCACCACTACTCGAGTAGTGGTGGCATTCAATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-1682s1c1
Sequence:CCGGCCCAGCTAATTGTCATTCCATCTCGAGATGGAATGACAATTAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-1423s1c1
Sequence:CCGGCCTCGTAAGATAACACCCTTTCTCGAGAAAGGGTGTTATCTTACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-412s1c1
Sequence:CCGGCTTCTGACATATCTTCCCAAACTCGAGTTTGGGAAGATATGTCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030790.2-1926s1c1
Sequence:CCGGGAATGGCTGTTCACTTGATTACTCGAGTAATCAAGTGAACAGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-411s1c1
Sequence:CCGGCCTTCTGACATATCTTCCCAACTCGAGTTGGGAAGATATGTCAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-1681s21c1
Sequence:CCGGCCCAGCTAATTGTCATTCCATCTCGAGATGGAATGACAATTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-730s21c1
Sequence:CCGGCGACATTGAATGCCACCACTACTCGAGTAGTGGTGGCATTCAATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030790.3-1925s21c1
Sequence:CCGGGAATGGCTGTTCACTTGATTACTCGAGTAATCAAGTGAACAGCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-1422s21c1
Sequence:CCGGCCTCGTAAGATAACACCCTTTCTCGAGAAAGGGTGTTATCTTACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-260s21c1
Sequence:CCGGGCTGCGGGAAAGAAATGACTTCTCGAGAAGTCATTTCTTTCCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030790
ITFG1 MISSION shRNA shRNA Plasmid DNA
integrin alpha FG-GAP repeat containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-261s1c1
Sequence:CCGGGCTGCGGGAAAGAAATGACTTCTCGAGAAGTCATTTCTTTCCCGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-1558s1c1
Sequence:CCGGCCATACAACGTGCTTGGTTTACTCGAGTAAACCAAGCACGTTGTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-731s1c1
Sequence:CCGGCGACATTGAATGCCACCACTACTCGAGTAGTGGTGGCATTCAATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-1682s1c1
Sequence:CCGGCCCAGCTAATTGTCATTCCATCTCGAGATGGAATGACAATTAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-1423s1c1
Sequence:CCGGCCTCGTAAGATAACACCCTTTCTCGAGAAAGGGTGTTATCTTACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-412s1c1
Sequence:CCGGCTTCTGACATATCTTCCCAAACTCGAGTTTGGGAAGATATGTCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030790.2-1926s1c1
Sequence:CCGGGAATGGCTGTTCACTTGATTACTCGAGTAATCAAGTGAACAGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-411s1c1
Sequence:CCGGCCTTCTGACATATCTTCCCAACTCGAGTTGGGAAGATATGTCAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-1681s21c1
Sequence:CCGGCCCAGCTAATTGTCATTCCATCTCGAGATGGAATGACAATTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-730s21c1
Sequence:CCGGCGACATTGAATGCCACCACTACTCGAGTAGTGGTGGCATTCAATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030790.3-1925s21c1
Sequence:CCGGGAATGGCTGTTCACTTGATTACTCGAGTAATCAAGTGAACAGCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-1422s21c1
Sequence:CCGGCCTCGTAAGATAACACCCTTTCTCGAGAAAGGGTGTTATCTTACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-260s21c1
Sequence:CCGGGCTGCGGGAAAGAAATGACTTCTCGAGAAGTCATTTCTTTCCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030790
ITFG1 MISSION shRNA Lentiviral Transduction Particles
integrin alpha FG-GAP repeat containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-261s1c1
Sequence:CCGGGCTGCGGGAAAGAAATGACTTCTCGAGAAGTCATTTCTTTCCCGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155809    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-1558s1c1
Sequence:CCGGCCATACAACGTGCTTGGTTTACTCGAGTAAACCAAGCACGTTGTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-731s1c1
Sequence:CCGGCGACATTGAATGCCACCACTACTCGAGTAGTGGTGGCATTCAATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-1682s1c1
Sequence:CCGGCCCAGCTAATTGTCATTCCATCTCGAGATGGAATGACAATTAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030790.2-1423s1c1
Sequence:CCGGCCTCGTAAGATAACACCCTTTCTCGAGAAAGGGTGTTATCTTACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-412s1c1
Sequence:CCGGCTTCTGACATATCTTCCCAAACTCGAGTTTGGGAAGATATGTCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151169    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030790.2-1926s1c1
Sequence:CCGGGAATGGCTGTTCACTTGATTACTCGAGTAATCAAGTGAACAGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030790.2-411s1c1
Sequence:CCGGCCTTCTGACATATCTTCCCAACTCGAGTTGGGAAGATATGTCAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-1681s21c1
Sequence:CCGGCCCAGCTAATTGTCATTCCATCTCGAGATGGAATGACAATTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-730s21c1
Sequence:CCGGCGACATTGAATGCCACCACTACTCGAGTAGTGGTGGCATTCAATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030790.3-1925s21c1
Sequence:CCGGGAATGGCTGTTCACTTGATTACTCGAGTAATCAAGTGAACAGCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-1422s21c1
Sequence:CCGGCCTCGTAAGATAACACCCTTTCTCGAGAAAGGGTGTTATCTTACGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030790.3-260s21c1
Sequence:CCGGGCTGCGGGAAAGAAATGACTTCTCGAGAAGTCATTTCTTTCCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028007
VALIDATED
ITFG1 MISSION shRNA Bacterial Glycerol Stock
integrin alpha FG-GAP repeat containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-1332s1c1
Sequence:CCGGGCAGATGCTTACTTTGTTAAACTCGAGTTTAACAAAGTAAGCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-1747s1c1
Sequence:CCGGCCCTCATTGGAGTCTGCATTTCTCGAGAAATGCAGACTCCAATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-308s1c1
Sequence:CCGGCCTGAAGACTTTGAGTGCGTTCTCGAGAACGCACTCAAAGTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-504s1c1
Sequence:CCGGCCACTGATTATGGACTTCAATCTCGAGATTGAAGTCCATAATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028007.1-1999s1c1
Sequence:CCGGCTGAAATAAATATGGCCTGAACTCGAGTTCAGGCCATATTTATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-1331s21c1
Sequence:CCGGGCAGATGCTTACTTTGTTAAACTCGAGTTTAACAAAGTAAGCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-1060s21c1
Sequence:CCGGCCCAGATGCTCTGGCTATATTCTCGAGAATATAGCCAGAGCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-2008s21c1
Sequence:CCGGTATGGCCTGAATATCTCATAACTCGAGTTATGAGATATTCAGGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-336s21c1
Sequence:CCGGGTGTGGTCCCTGGTGATTATGCTCGAGCATAATCACCAGGGACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-503s21c1
Sequence:CCGGCCACTGATTATGGACTTCAATCTCGAGATTGAAGTCCATAATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028007
VALIDATED
ITFG1 MISSION shRNA shRNA Plasmid DNA
integrin alpha FG-GAP repeat containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-1332s1c1
Sequence:CCGGGCAGATGCTTACTTTGTTAAACTCGAGTTTAACAAAGTAAGCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-1747s1c1
Sequence:CCGGCCCTCATTGGAGTCTGCATTTCTCGAGAAATGCAGACTCCAATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-308s1c1
Sequence:CCGGCCTGAAGACTTTGAGTGCGTTCTCGAGAACGCACTCAAAGTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-504s1c1
Sequence:CCGGCCACTGATTATGGACTTCAATCTCGAGATTGAAGTCCATAATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028007.1-1999s1c1
Sequence:CCGGCTGAAATAAATATGGCCTGAACTCGAGTTCAGGCCATATTTATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-1331s21c1
Sequence:CCGGGCAGATGCTTACTTTGTTAAACTCGAGTTTAACAAAGTAAGCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-1060s21c1
Sequence:CCGGCCCAGATGCTCTGGCTATATTCTCGAGAATATAGCCAGAGCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-2008s21c1
Sequence:CCGGTATGGCCTGAATATCTCATAACTCGAGTTATGAGATATTCAGGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-336s21c1
Sequence:CCGGGTGTGGTCCCTGGTGATTATGCTCGAGCATAATCACCAGGGACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-503s21c1
Sequence:CCGGCCACTGATTATGGACTTCAATCTCGAGATTGAAGTCCATAATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028007
VALIDATED
ITFG1 MISSION shRNA Lentiviral Transduction Particles
integrin alpha FG-GAP repeat containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-1332s1c1
Sequence:CCGGGCAGATGCTTACTTTGTTAAACTCGAGTTTAACAAAGTAAGCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-1747s1c1
Sequence:CCGGCCCTCATTGGAGTCTGCATTTCTCGAGAAATGCAGACTCCAATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-308s1c1
Sequence:CCGGCCTGAAGACTTTGAGTGCGTTCTCGAGAACGCACTCAAAGTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028007.1-504s1c1
Sequence:CCGGCCACTGATTATGGACTTCAATCTCGAGATTGAAGTCCATAATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028007.1-1999s1c1
Sequence:CCGGCTGAAATAAATATGGCCTGAACTCGAGTTCAGGCCATATTTATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-1331s21c1
Sequence:CCGGGCAGATGCTTACTTTGTTAAACTCGAGTTTAACAAAGTAAGCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-1060s21c1
Sequence:CCGGCCCAGATGCTCTGGCTATATTCTCGAGAATATAGCCAGAGCATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-2008s21c1
Sequence:CCGGTATGGCCTGAATATCTCATAACTCGAGTTATGAGATATTCAGGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-336s21c1
Sequence:CCGGGTGTGGTCCCTGGTGATTATGCTCGAGCATAATCACCAGGGACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028007.2-503s21c1
Sequence:CCGGCCACTGATTATGGACTTCAATCTCGAGATTGAAGTCCATAATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)