EMAIL THIS PAGE TO A FRIEND

ITFG2

integrin alpha FG-GAP repeat containing 2

58 Gene Product Result for
Synonyms: MDS028
UniProtKB ID: Q969R8, A8K4Z5, D3DUQ2, Q96SX6
Gene ID:
Mouse(101142) integrin alpha FG-GAP repeat containing 2
Rat(362441) integrin alpha FG-GAP repeat containing 2
sheep(101119126) integrin alpha FG-GAP repeat containing 2
Domestic Rabbit(100356625) integrin alpha FG-GAP repeat containing 2
domestic guinea pig(100716787) integrin alpha FG-GAP repeat containing 2
naked mole-rat(101711532) integrin alpha FG-GAP repeat containing 2
Zebrafish(550607) integrin alpha FG-GAP repeat containing 2
cow(282275) integrin alpha FG-GAP repeat containing 2
Horse(100050697) integrin alpha FG-GAP repeat containing 2
domestic cat(101088849) integrin alpha FG-GAP repeat containing 2
dog(611853) integrin alpha FG-GAP repeat containing 2
chicken(418262) integrin alpha FG-GAP repeat containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105635 Anti-ITFG2 (114-125) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105636 Anti-ITFG2 (242-255) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1407705 Anti-ITFG2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA038664 Anti-ITFG2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1411084 Anti-ITFG2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411786 ANTI-MDS028 antibody produced in mouse clone 2C7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411787 ANTI-MDS028 antibody produced in mouse clone 2E8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411788 ANTI-MDS028 antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1401765 Monoclonal Anti-ITFG2 antibody produced in mouse clone 1A8, ascites fluid human
ELISA, western blot pricing
WH0055846M2 Monoclonal Anti-MDS028 antibody produced in mouse clone 1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405166 Monoclonal Anti-MDS028 antibody produced in mouse clone 3D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133927 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133927 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133927 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037091 MISSION® esiRNA esiRNA human ITFG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018463 Rosetta Predictions human pricing
NM_001108648 Rosetta Predictions rat pricing
NM_133927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352023 predicted 1177
2 SASI_Hs01_00141031 predicted 819
3 SASI_Hs01_00141032 predicted 329
4 SASI_Hs01_00141033 predicted 825
5 SASI_Hs01_00141034 predicted 1232
6 SASI_Hs01_00141035 predicted 1476
7 SASI_Hs01_00141036 predicted 1414
8 SASI_Hs01_00141037 predicted 826
9 SASI_Hs01_00141038 predicted 731
10 SASI_Hs01_00141039 predicted 1165
11 SASI_Hs01_00141040 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108648 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240699 predicted 853
2 SASI_Rn02_00240700 predicted 816
3 SASI_Rn02_00240701 predicted 1349
4 SASI_Rn02_00240702 predicted 1088
5 SASI_Rn02_00240703 predicted 867
6 SASI_Rn02_00240704 predicted 501
7 SASI_Rn02_00240705 predicted 1262
8 SASI_Rn02_00240706 predicted 197
9 SASI_Rn02_00240707 predicted 883
10 SASI_Rn02_00240708 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093932 predicted 846
2 SASI_Mm01_00093934 predicted 889
3 SASI_Mm01_00093935 predicted 872
4 SASI_Mm01_00093936 predicted 218
5 SASI_Mm01_00093937 predicted 856
6 SASI_Mm01_00093938 predicted 1079
7 SASI_Mm02_00339027 predicted 332
8 SASI_Mm01_00093939 predicted 265
9 SASI_Mm01_00093940 predicted 505
10 SASI_Mm01_00093941 predicted 228
11 SASI_Mm01_00093933 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018463
VALIDATED
ITFG2 MISSION shRNA Bacterial Glycerol Stock
integrin alpha FG-GAP repeat containing 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-1097s21c1
Sequence:CCGGGCATGAGGAGGTAGTTGCATGCTCGAGCATGCAACTACCTCCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-948s21c1
Sequence:CCGGAGTAGTGGCTCTGGCCTCTTTCTCGAGAAAGAGGCCAGAGCCACTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018463.3-1593s21c1
Sequence:CCGGATTTGACTCTGGGCATGAAAGCTCGAGCTTTCATGCCCAGAGTCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-1165s21c1
Sequence:CCGGTCCGCTTCCAAGTGGATGAAACTCGAGTTTCATCCACTTGGAAGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-898s21c1
Sequence:CCGGATGTCTCCACTCACCTAATTGCTCGAGCAATTAGGTGAGTGGAGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-620s21c1
Sequence:CCGGAGGTGAGGGTCCTGAACATCTCTCGAGAGATGTTCAGGACCCTCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-872s21c1
Sequence:CCGGGACATCTGGCCGTATCCACAACTCGAGTTGTGGATACGGCCAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018463.2-1164s1c1
Sequence:CCGGCCTGCCTCGTATATGTCACTTCTCGAGAAGTGACATATACGAGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018463.2-1587s1c1
Sequence:CCGGCGGTGAAAGAAGAGACAAGTTCTCGAGAACTTGTCTCTTCTTTCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018463.2-1232s1c1
Sequence:CCGGGAGTCTACCAATCTGGTGAAACTCGAGTTTCACCAGATTGGTAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018463.2-681s1c1
Sequence:CCGGCGTATGCAATTCTACTGTGTACTCGAGTACACAGTAGAATTGCATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018463.2-143s1c1
Sequence:CCGGGACGTTGATAACGATACGTTACTCGAGTAACGTATCGTTATCAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018463.2-1461s1c1
Sequence:CCGGCCTAAAGGTATCTGTGGTATTCTCGAGAATACCACAGATACCTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018463.2-671s1c1
Sequence:CCGGCCAGGTTGTGCGTATGCAATTCTCGAGAATTGCATACGCACAACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018463
VALIDATED
ITFG2 MISSION shRNA shRNA Plasmid DNA
integrin alpha FG-GAP repeat containing 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-1097s21c1
Sequence:CCGGGCATGAGGAGGTAGTTGCATGCTCGAGCATGCAACTACCTCCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-948s21c1
Sequence:CCGGAGTAGTGGCTCTGGCCTCTTTCTCGAGAAAGAGGCCAGAGCCACTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018463.3-1593s21c1
Sequence:CCGGATTTGACTCTGGGCATGAAAGCTCGAGCTTTCATGCCCAGAGTCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-1165s21c1
Sequence:CCGGTCCGCTTCCAAGTGGATGAAACTCGAGTTTCATCCACTTGGAAGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-898s21c1
Sequence:CCGGATGTCTCCACTCACCTAATTGCTCGAGCAATTAGGTGAGTGGAGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-620s21c1
Sequence:CCGGAGGTGAGGGTCCTGAACATCTCTCGAGAGATGTTCAGGACCCTCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-872s21c1
Sequence:CCGGGACATCTGGCCGTATCCACAACTCGAGTTGTGGATACGGCCAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018463.2-1164s1c1
Sequence:CCGGCCTGCCTCGTATATGTCACTTCTCGAGAAGTGACATATACGAGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018463.2-1587s1c1
Sequence:CCGGCGGTGAAAGAAGAGACAAGTTCTCGAGAACTTGTCTCTTCTTTCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018463.2-1232s1c1
Sequence:CCGGGAGTCTACCAATCTGGTGAAACTCGAGTTTCACCAGATTGGTAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018463.2-681s1c1
Sequence:CCGGCGTATGCAATTCTACTGTGTACTCGAGTACACAGTAGAATTGCATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018463.2-143s1c1
Sequence:CCGGGACGTTGATAACGATACGTTACTCGAGTAACGTATCGTTATCAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018463.2-1461s1c1
Sequence:CCGGCCTAAAGGTATCTGTGGTATTCTCGAGAATACCACAGATACCTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018463.2-671s1c1
Sequence:CCGGCCAGGTTGTGCGTATGCAATTCTCGAGAATTGCATACGCACAACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018463
VALIDATED
ITFG2 MISSION shRNA Lentiviral Transduction Particles
integrin alpha FG-GAP repeat containing 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-1097s21c1
Sequence:CCGGGCATGAGGAGGTAGTTGCATGCTCGAGCATGCAACTACCTCCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-948s21c1
Sequence:CCGGAGTAGTGGCTCTGGCCTCTTTCTCGAGAAAGAGGCCAGAGCCACTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018463.3-1593s21c1
Sequence:CCGGATTTGACTCTGGGCATGAAAGCTCGAGCTTTCATGCCCAGAGTCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-1165s21c1
Sequence:CCGGTCCGCTTCCAAGTGGATGAAACTCGAGTTTCATCCACTTGGAAGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-898s21c1
Sequence:CCGGATGTCTCCACTCACCTAATTGCTCGAGCAATTAGGTGAGTGGAGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-620s21c1
Sequence:CCGGAGGTGAGGGTCCTGAACATCTCTCGAGAGATGTTCAGGACCCTCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018463.3-872s21c1
Sequence:CCGGGACATCTGGCCGTATCCACAACTCGAGTTGTGGATACGGCCAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018463.2-1164s1c1
Sequence:CCGGCCTGCCTCGTATATGTCACTTCTCGAGAAGTGACATATACGAGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018463.2-1587s1c1
Sequence:CCGGCGGTGAAAGAAGAGACAAGTTCTCGAGAACTTGTCTCTTCTTTCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018463.2-1232s1c1
Sequence:CCGGGAGTCTACCAATCTGGTGAAACTCGAGTTTCACCAGATTGGTAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_018463.2-681s1c1
Sequence:CCGGCGTATGCAATTCTACTGTGTACTCGAGTACACAGTAGAATTGCATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018463.2-143s1c1
Sequence:CCGGGACGTTGATAACGATACGTTACTCGAGTAACGTATCGTTATCAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018463.2-1461s1c1
Sequence:CCGGCCTAAAGGTATCTGTGGTATTCTCGAGAATACCACAGATACCTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018463.2-671s1c1
Sequence:CCGGCCAGGTTGTGCGTATGCAATTCTCGAGAATTGCATACGCACAACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133927
VALIDATED
ITFG2 MISSION shRNA Bacterial Glycerol Stock
integrin alpha FG-GAP repeat containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-850s21c1
Sequence:CCGGGAACGTCTCCACTCACCTAATCTCGAGATTAGGTGAGTGGAGACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-306s21c1
Sequence:CCGGTCGGAGATGTCTGTAATAAAGCTCGAGCTTTATTACAGACATCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-179s21c1
Sequence:CCGGGTGGATAACGACGCGTTAAATCTCGAGATTTAACGCGTCGTTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-873s21c1
Sequence:CCGGGCAACATCAGACAAGGTCATACTCGAGTATGACCTTGTCTGATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133927.1-1815s21c1
Sequence:CCGGCGCAGTTATTGCAGGAATGAACTCGAGTTCATTCCTGCAATAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-1815s1c1
Sequence:CCGGCGCAGTTATTGCAGGAATGAACTCGAGTTCATTCCTGCAATAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-1188s1c1
Sequence:CCGGGCTTGGTATATGTCACCTTCACTCGAGTGAAGGTGACATATACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133927.1-223s1c1
Sequence:CCGGCGGGAAACTGTCCGTGTATAACTCGAGTTATACACGGACAGTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133927.1-873s1c1
Sequence:CCGGGCAACATCAGACAAGGTCATACTCGAGTATGACCTTGTCTGATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-280s1c1
Sequence:CCGGCCAGGGAATGTTGACTTGTGTCTCGAGACACAAGTCAACATTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133927
VALIDATED
ITFG2 MISSION shRNA shRNA Plasmid DNA
integrin alpha FG-GAP repeat containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-850s21c1
Sequence:CCGGGAACGTCTCCACTCACCTAATCTCGAGATTAGGTGAGTGGAGACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-306s21c1
Sequence:CCGGTCGGAGATGTCTGTAATAAAGCTCGAGCTTTATTACAGACATCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-179s21c1
Sequence:CCGGGTGGATAACGACGCGTTAAATCTCGAGATTTAACGCGTCGTTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-873s21c1
Sequence:CCGGGCAACATCAGACAAGGTCATACTCGAGTATGACCTTGTCTGATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133927.1-1815s21c1
Sequence:CCGGCGCAGTTATTGCAGGAATGAACTCGAGTTCATTCCTGCAATAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-1815s1c1
Sequence:CCGGCGCAGTTATTGCAGGAATGAACTCGAGTTCATTCCTGCAATAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-1188s1c1
Sequence:CCGGGCTTGGTATATGTCACCTTCACTCGAGTGAAGGTGACATATACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133927.1-223s1c1
Sequence:CCGGCGGGAAACTGTCCGTGTATAACTCGAGTTATACACGGACAGTTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133927.1-873s1c1
Sequence:CCGGGCAACATCAGACAAGGTCATACTCGAGTATGACCTTGTCTGATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-280s1c1
Sequence:CCGGCCAGGGAATGTTGACTTGTGTCTCGAGACACAAGTCAACATTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133927
VALIDATED
ITFG2 MISSION shRNA Lentiviral Transduction Particles
integrin alpha FG-GAP repeat containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-850s21c1
Sequence:CCGGGAACGTCTCCACTCACCTAATCTCGAGATTAGGTGAGTGGAGACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-306s21c1
Sequence:CCGGTCGGAGATGTCTGTAATAAAGCTCGAGCTTTATTACAGACATCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-179s21c1
Sequence:CCGGGTGGATAACGACGCGTTAAATCTCGAGATTTAACGCGTCGTTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133927.1-873s21c1
Sequence:CCGGGCAACATCAGACAAGGTCATACTCGAGTATGACCTTGTCTGATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133927.1-1815s21c1
Sequence:CCGGCGCAGTTATTGCAGGAATGAACTCGAGTTCATTCCTGCAATAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-1815s1c1
Sequence:CCGGCGCAGTTATTGCAGGAATGAACTCGAGTTCATTCCTGCAATAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-1188s1c1
Sequence:CCGGGCTTGGTATATGTCACCTTCACTCGAGTGAAGGTGACATATACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133927.1-223s1c1
Sequence:CCGGCGGGAAACTGTCCGTGTATAACTCGAGTTATACACGGACAGTTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133927.1-873s1c1
Sequence:CCGGGCAACATCAGACAAGGTCATACTCGAGTATGACCTTGTCTGATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133927.1-280s1c1
Sequence:CCGGCCAGGGAATGTTGACTTGTGTCTCGAGACACAAGTCAACATTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)