EMAIL THIS PAGE TO A FRIEND

ITFG3

integrin alpha FG-GAP repeat containing 3

60 Gene Product Result for
Synonyms: C16orf9 gs19
UniProtKB ID: Q9H0X4, D3DU45, Q7L416, Q96FR1, Q96MC7, Q96S30
Gene ID:
Mouse(106581) integrin alpha FG-GAP repeat containing 3
Rat(360502) integrin alpha FG-GAP repeat containing 3
chicken(416653) integrin alpha FG-GAP repeat containing 3
dog(490100) integrin alpha FG-GAP repeat containing 3
domestic cat(101089316) integrin alpha FG-GAP repeat containing 3
cow(507493) integrin alpha FG-GAP repeat containing 3
domestic guinea pig(100713149) integrin alpha FG-GAP repeat containing 3
naked mole-rat(101702921) integrin alpha FG-GAP repeat containing 3
sheep(101109320) integrin alpha FG-GAP repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032039 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032039 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032039 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032039 Rosetta Predictions human pricing
NM_001009701 Rosetta Predictions rat pricing
XM_001061626 Rosetta Predictions rat pricing
NM_207217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032039 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213888 predicted 1020
2 SASI_Hs01_00213889 predicted 1752
3 SASI_Hs01_00213890 predicted 1228
4 SASI_Hs01_00213891 predicted 1782
5 SASI_Hs01_00213892 predicted 1443
6 SASI_Hs01_00213893 predicted 511
7 SASI_Hs01_00213894 predicted 468
8 SASI_Hs01_00213895 predicted 1179
9 SASI_Hs01_00213897 predicted 1575
10 SASI_Hs02_00359236 predicted 941
11 SASI_Hs01_00213896 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199760 predicted 1565
2 SASI_Rn01_00113393 predicted 1493
3 SASI_Rn02_00199761 predicted 996
4 SASI_Rn02_00199762 predicted 1563
5 SASI_Rn01_00113394 predicted 210
6 SASI_Rn01_00113395 predicted 1227
7 SASI_Rn01_00113396 predicted 1310
8 SASI_Rn01_00113397 predicted 588
9 SASI_Rn01_00113398 predicted 590
10 SASI_Rn01_00113399 predicted 538
11 SASI_Rn01_00113392 predicted 680
12 SASI_Rn01_00113400 predicted 1066
13 SASI_Rn01_00113401 predicted 1562
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300747 predicted 592
2 SASI_Rn02_00300748 predicted 620
3 SASI_Rn02_00300749 predicted 308
4 SASI_Rn02_00300750 predicted 997
5 SASI_Rn02_00300751 predicted 977
6 SASI_Rn02_00300752 predicted 1065
7 SASI_Rn02_00300753 predicted 1195
8 SASI_Rn02_00300754 predicted 450
9 SASI_Rn02_00300755 predicted 393
10 SASI_Rn02_00300756 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059394 predicted 719
2 SASI_Mm01_00059395 predicted 1614
3 SASI_Mm01_00059396 predicted 1610
4 SASI_Mm01_00059397 predicted 1036
5 SASI_Mm01_00059398 predicted 629
6 SASI_Mm01_00059399 predicted 1484
7 SASI_Mm01_00059400 predicted 474
8 SASI_Mm01_00059401 predicted 681
9 SASI_Mm01_00059402 predicted 235
10 SASI_Mm01_00059403 predicted 511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207217
VALIDATED
ITFG3 MISSION shRNA Bacterial Glycerol Stock
integrin alpha FG-GAP repeat containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-1495s1c1
Sequence:CCGGCCATGATCTTGTGAGCACTAACTCGAGTTAGTGCTCACAAGATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207217.1-1505s1c1
Sequence:CCGGGTGAGCACTAATGAGATGGATCTCGAGATCCATCTCATTAGTGCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-774s1c1
Sequence:CCGGGCAGCTTTAGTGGGAACGTTTCTCGAGAAACGTTCCCACTAAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-984s1c1
Sequence:CCGGCCAGAACTGGTGCTCAGTATACTCGAGTATACTGAGCACCAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207217
VALIDATED
ITFG3 MISSION shRNA shRNA Plasmid DNA
integrin alpha FG-GAP repeat containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-1495s1c1
Sequence:CCGGCCATGATCTTGTGAGCACTAACTCGAGTTAGTGCTCACAAGATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207217.1-1505s1c1
Sequence:CCGGGTGAGCACTAATGAGATGGATCTCGAGATCCATCTCATTAGTGCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-774s1c1
Sequence:CCGGGCAGCTTTAGTGGGAACGTTTCTCGAGAAACGTTCCCACTAAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-984s1c1
Sequence:CCGGCCAGAACTGGTGCTCAGTATACTCGAGTATACTGAGCACCAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207217
VALIDATED
ITFG3 MISSION shRNA Lentiviral Transduction Particles
integrin alpha FG-GAP repeat containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-1495s1c1
Sequence:CCGGCCATGATCTTGTGAGCACTAACTCGAGTTAGTGCTCACAAGATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207217.1-1505s1c1
Sequence:CCGGGTGAGCACTAATGAGATGGATCTCGAGATCCATCTCATTAGTGCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-774s1c1
Sequence:CCGGGCAGCTTTAGTGGGAACGTTTCTCGAGAAACGTTCCCACTAAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207217.1-984s1c1
Sequence:CCGGCCAGAACTGGTGCTCAGTATACTCGAGTATACTGAGCACCAGTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032039
VALIDATED
ITFG3 MISSION shRNA Bacterial Glycerol Stock
integrin alpha FG-GAP repeat containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-1350s1c1
Sequence:CCGGCAGATCCTGTTTCTGGACCTTCTCGAGAAGGTCCAGAAACAGGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-401s1c1
Sequence:CCGGGCGAATGTGGAGGATAGACTACTCGAGTAGTCTATCCTCCACATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-710s1c1
Sequence:CCGGCAGTTCTTTCATTGCAGTCAACTCGAGTTGACTGCAATGAAAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-353s1c1
Sequence:CCGGGTTCGTCGTCTCATTCGTCATCTCGAGATGACGAATGAGACGACGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-709s1c1
Sequence:CCGGCCAGTTCTTTCATTGCAGTCACTCGAGTGACTGCAATGAAAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-1118s21c1
Sequence:CCGGACTGGGAGAGCATGCTCAATGCTCGAGCATTGAGCATGCTCTCCCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-1340s21c1
Sequence:CCGGCCTTGGCTGTAGCCGTTGAAACTCGAGTTTCAACGGCTACAGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-476s21c1
Sequence:CCGGTTCTGGCTGTGGATGATATAACTCGAGTTATATCATCCACAGCCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032039
VALIDATED
ITFG3 MISSION shRNA shRNA Plasmid DNA
integrin alpha FG-GAP repeat containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-1350s1c1
Sequence:CCGGCAGATCCTGTTTCTGGACCTTCTCGAGAAGGTCCAGAAACAGGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-401s1c1
Sequence:CCGGGCGAATGTGGAGGATAGACTACTCGAGTAGTCTATCCTCCACATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-710s1c1
Sequence:CCGGCAGTTCTTTCATTGCAGTCAACTCGAGTTGACTGCAATGAAAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-353s1c1
Sequence:CCGGGTTCGTCGTCTCATTCGTCATCTCGAGATGACGAATGAGACGACGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-709s1c1
Sequence:CCGGCCAGTTCTTTCATTGCAGTCACTCGAGTGACTGCAATGAAAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-1118s21c1
Sequence:CCGGACTGGGAGAGCATGCTCAATGCTCGAGCATTGAGCATGCTCTCCCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-1340s21c1
Sequence:CCGGCCTTGGCTGTAGCCGTTGAAACTCGAGTTTCAACGGCTACAGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-476s21c1
Sequence:CCGGTTCTGGCTGTGGATGATATAACTCGAGTTATATCATCCACAGCCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032039
VALIDATED
ITFG3 MISSION shRNA Lentiviral Transduction Particles
integrin alpha FG-GAP repeat containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-1350s1c1
Sequence:CCGGCAGATCCTGTTTCTGGACCTTCTCGAGAAGGTCCAGAAACAGGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-401s1c1
Sequence:CCGGGCGAATGTGGAGGATAGACTACTCGAGTAGTCTATCCTCCACATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-710s1c1
Sequence:CCGGCAGTTCTTTCATTGCAGTCAACTCGAGTTGACTGCAATGAAAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-353s1c1
Sequence:CCGGGTTCGTCGTCTCATTCGTCATCTCGAGATGACGAATGAGACGACGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_032039.1-709s1c1
Sequence:CCGGCCAGTTCTTTCATTGCAGTCACTCGAGTGACTGCAATGAAAGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-1118s21c1
Sequence:CCGGACTGGGAGAGCATGCTCAATGCTCGAGCATTGAGCATGCTCTCCCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-1340s21c1
Sequence:CCGGCCTTGGCTGTAGCCGTTGAAACTCGAGTTTCAACGGCTACAGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032039.2-476s21c1
Sequence:CCGGTTCTGGCTGTGGATGATATAACTCGAGTTATATCATCCACAGCCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)