EMAIL THIS PAGE TO A FRIEND

ITGA10

integrin, alpha 10

188 Gene Product Result for
Synonyms: PRO827
UniProtKB ID: O75578, B2RAM4, Q6UXJ6, Q9UHZ8
Gene ID:
Human(8515) Summary: Integrins are integral membrane proteins composed of an alpha chain and a beta chain, and are known to participate in cell adhesion as well as cell-surface mediated signalling. The I-domain containing alpha 10 combines with the integrin beta 1 chain (ITGB1) to form a novel collagen type II-binding integrin expressed in cartilage tissue. [provided by RefSeq, Jul 2008]
Mouse(213119) integrin, alpha 10
Rat(310683) integrin, alpha 10
Zebrafish(572348) integrin, alpha 10
cow(506526) integrin, alpha 10
Horse(100065205) integrin, alpha 10
domestic cat(101097997) integrin, alpha 10
dog(608287) integrin, alpha 10
domestic guinea pig(100719833) integrin, alpha 10
naked mole-rat(101701994) integrin, alpha 10
sheep(101117377) integrin, alpha 10
Domestic Rabbit(100340248) integrin, alpha 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA064008 Anti-ITGA10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_112192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_112192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_112192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007761 MISSION® esiRNA esiRNA targeting human ITGA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003637 Rosetta Predictions human pricing
NM_001107699 Rosetta Predictions rat pricing
NM_001081053 Rosetta Predictions mouse pricing
XM_112192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066327 predicted 1047
2 SASI_Hs01_00066328 predicted 2921
3 SASI_Hs01_00066329 predicted 3076
4 SASI_Hs01_00066330 predicted 1936
5 SASI_Hs01_00066331 predicted 1567
6 SASI_Hs01_00066332 predicted 3614
7 SASI_Hs01_00066333 predicted 1211
8 SASI_Hs02_00335991 predicted 3332
9 SASI_Hs01_00066334 predicted 557
10 SASI_Hs01_00066335 predicted 2429
11 SASI_Hs01_00066336 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231405 predicted 2894
2 SASI_Rn02_00231406 predicted 1422
3 SASI_Rn02_00231407 predicted 958
4 SASI_Rn02_00231408 predicted 1996
5 SASI_Rn02_00231409 predicted 938
6 SASI_Rn02_00231410 predicted 2809
7 SASI_Rn02_00231411 predicted 1029
8 SASI_Rn02_00231412 predicted 2285
9 SASI_Rn02_00231413 predicted 2565
10 SASI_Rn02_00231414 predicted 2626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294711 predicted 2902
2 SASI_Mm02_00294712 predicted 1912
3 SASI_Mm02_00294713 predicted 2544
4 SASI_Mm02_00294714 predicted 1420
5 SASI_Mm02_00294715 predicted 966
6 SASI_Mm02_00294716 predicted 572
7 SASI_Mm02_00294717 predicted 1035
8 SASI_Mm02_00294718 predicted 1607
9 SASI_Mm02_00294719 predicted 894
10 SASI_Mm02_00294720 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_112192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207030 predicted 2902
2 SASI_Mm01_00207031 predicted 1924
3 SASI_Mm01_00207032 predicted 1434
4 SASI_Mm01_00207033 predicted 967
5 SASI_Mm01_00207034 predicted 578
6 SASI_Mm01_00207035 predicted 1042
7 SASI_Mm01_00207036 predicted 1615
8 SASI_Mm01_00207037 predicted 905
9 SASI_Mm01_00207038 predicted 943
10 SASI_Mm01_00207039 predicted 2287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003637
ITGA10 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 10
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003637.3-155s21c1
Sequence:CCGGGAACATCACCCACGCCTATTCCTCGAGGAATAGGCGTGGGTGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-1217s1c1
Sequence:CCGGCGGCTAAAGGATGGGATTCTTCTCGAGAAGAATCCCATCCTTTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003637.3-3947s21c1
Sequence:CCGGTTGGAAAGGATGAGGGTTATCCTCGAGGATAACCCTCATCCTTTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-1030s1c1
Sequence:CCGGCCTGAGAGAAATTAGAACTATCTCGAGATAGTTCTAATTTCTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-797s1c1
Sequence:CCGGCGAGAAACAAAGACTGCCCAACTCGAGTTGGGCAGTCTTTGTTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-3173s1c1
Sequence:CCGGCAACACACAAACAGACTGAATCTCGAGATTCAGTCTGTTTGTGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-2927s1c1
Sequence:CCGGCGCTATGAGGTTCACCCATATCTCGAGATATGGGTGAACCTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003637
ITGA10 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 10
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003637.3-155s21c1
Sequence:CCGGGAACATCACCCACGCCTATTCCTCGAGGAATAGGCGTGGGTGATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-1217s1c1
Sequence:CCGGCGGCTAAAGGATGGGATTCTTCTCGAGAAGAATCCCATCCTTTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003637.3-3947s21c1
Sequence:CCGGTTGGAAAGGATGAGGGTTATCCTCGAGGATAACCCTCATCCTTTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-1030s1c1
Sequence:CCGGCCTGAGAGAAATTAGAACTATCTCGAGATAGTTCTAATTTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-797s1c1
Sequence:CCGGCGAGAAACAAAGACTGCCCAACTCGAGTTGGGCAGTCTTTGTTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-3173s1c1
Sequence:CCGGCAACACACAAACAGACTGAATCTCGAGATTCAGTCTGTTTGTGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-2927s1c1
Sequence:CCGGCGCTATGAGGTTCACCCATATCTCGAGATATGGGTGAACCTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003637
ITGA10 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 10
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003637.3-155s21c1
Sequence:CCGGGAACATCACCCACGCCTATTCCTCGAGGAATAGGCGTGGGTGATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-1217s1c1
Sequence:CCGGCGGCTAAAGGATGGGATTCTTCTCGAGAAGAATCCCATCCTTTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003637.3-3947s21c1
Sequence:CCGGTTGGAAAGGATGAGGGTTATCCTCGAGGATAACCCTCATCCTTTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-1030s1c1
Sequence:CCGGCCTGAGAGAAATTAGAACTATCTCGAGATAGTTCTAATTTCTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-797s1c1
Sequence:CCGGCGAGAAACAAAGACTGCCCAACTCGAGTTGGGCAGTCTTTGTTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-3173s1c1
Sequence:CCGGCAACACACAAACAGACTGAATCTCGAGATTCAGTCTGTTTGTGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003637.3-2927s1c1
Sequence:CCGGCGCTATGAGGTTCACCCATATCTCGAGATATGGGTGAACCTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_112192
ITGA10 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-1363s1c1
Sequence:CCGGCGAGGTTTAGACATCGAGGAACTCGAGTTCCTCGATGTCTAAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-2731s1c1
Sequence:CCGGGCTTCCTGTTAGAGTTTGAATCTCGAGATTCAAACTCTAACAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_112192.6-4492s1c1
Sequence:CCGGCCCTGAGATAGATCCAAACAACTCGAGTTGTTTGGATCTATCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-3062s1c1
Sequence:CCGGCCTGTCACTATCTCAAGTCATCTCGAGATGACTTGAGATAGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-574s1c1
Sequence:CCGGCCTGGTCAGAAGTTCAGACTTCTCGAGAAGTCTGAACTTCTGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_112192
ITGA10 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-1363s1c1
Sequence:CCGGCGAGGTTTAGACATCGAGGAACTCGAGTTCCTCGATGTCTAAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-2731s1c1
Sequence:CCGGGCTTCCTGTTAGAGTTTGAATCTCGAGATTCAAACTCTAACAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_112192.6-4492s1c1
Sequence:CCGGCCCTGAGATAGATCCAAACAACTCGAGTTGTTTGGATCTATCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-3062s1c1
Sequence:CCGGCCTGTCACTATCTCAAGTCATCTCGAGATGACTTGAGATAGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-574s1c1
Sequence:CCGGCCTGGTCAGAAGTTCAGACTTCTCGAGAAGTCTGAACTTCTGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_112192
ITGA10 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-1363s1c1
Sequence:CCGGCGAGGTTTAGACATCGAGGAACTCGAGTTCCTCGATGTCTAAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-2731s1c1
Sequence:CCGGGCTTCCTGTTAGAGTTTGAATCTCGAGATTCAAACTCTAACAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_112192.6-4492s1c1
Sequence:CCGGCCCTGAGATAGATCCAAACAACTCGAGTTGTTTGGATCTATCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-3062s1c1
Sequence:CCGGCCTGTCACTATCTCAAGTCATCTCGAGATGACTTGAGATAGTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_112192.6-574s1c1
Sequence:CCGGCCTGGTCAGAAGTTCAGACTTCTCGAGAAGTCTGAACTTCTGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)