EMAIL THIS PAGE TO A FRIEND

ITGA2

integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)

129 Gene Product Result for
Synonyms: BR CD49B GPIa HPA-5 VLA-2 VLAA2
UniProtKB ID: P17301, Q14595
Gene ID:
Human(3673) Summary: This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(16398) integrin alpha 2
Rat(170921) integrin, alpha 2
chicken(100857227) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
domestic cat(101090237) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
dog(489208) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
cow(281872) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
domestic guinea pig(100729266) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
naked mole-rat(101702532) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
sheep(101119848) integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008396 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008396 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008396 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002203 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040531 MISSION® esiRNA esiRNA human ITGA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002203 Rosetta Predictions human pricing
XM_001075558 Rosetta Predictions rat pricing
XM_345156 Rosetta Predictions rat pricing
NM_008396 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123982 predicted 965
2 SASI_Hs01_00123983 predicted 323
3 SASI_Hs01_00123985 predicted 999
4 SASI_Hs01_00123986 predicted 3088
5 SASI_Hs01_00123988 predicted 465
6 SASI_Hs01_00123989 predicted 1368
7 SASI_Hs01_00123990 predicted 1273
8 SASI_Hs02_00333424 predicted 2796
9 SASI_Hs01_00123991 predicted 2754
10 SASI_Hs02_00333425 predicted 650
11 SASI_Hs01_00123984 predicted 960
12 SASI_Hs01_00123987 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350248 predicted 3287
2 SASI_Rn02_00350249 predicted 2496
3 SASI_Rn02_00350250 predicted 2270
4 SASI_Rn02_00350251 predicted 489
5 SASI_Rn02_00350252 predicted 2158
6 SASI_Rn02_00350253 predicted 1822
7 SASI_Rn02_00350254 predicted 3017
8 SASI_Rn02_00350255 predicted 793
9 SASI_Rn02_00350256 predicted 812
10 SASI_Rn02_00350257 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398021 predicted 3281
2 SASI_Rn02_00398022 predicted 2501
3 SASI_Rn02_00398023 predicted 2268
4 SASI_Rn02_00398024 predicted 489
5 SASI_Rn02_00398025 predicted 2166
6 SASI_Rn02_00398026 predicted 3022
7 SASI_Rn02_00398027 predicted 792
8 SASI_Rn02_00398028 predicted 818
9 SASI_Rn02_00398029 predicted 1100
10 SASI_Rn02_00398030 predicted 2476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313827 predicted 3304
2 SASI_Mm01_00097732 predicted 2886
3 SASI_Mm01_00097733 predicted 3284
4 SASI_Mm01_00097734 predicted 1489
5 SASI_Mm02_00313828 predicted 1500
6 SASI_Mm01_00097736 predicted 444
7 SASI_Mm01_00097737 predicted 2209
8 SASI_Mm01_00097739 predicted 1513
9 SASI_Mm01_00097740 predicted 1913
10 SASI_Mm01_00097741 predicted 1760
11 SASI_Mm01_00097735 predicted 2913
12 SASI_Mm01_00097738 predicted 3297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008396
VALIDATED
ITGA2 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-145s21c1
Sequence:CCGGCGGCTGCTAATGCTAGTTCAACTCGAGTTGAACTAGCATTAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-872s21c1
Sequence:CCGGTCGCAAGAGACTACGCTTATTCTCGAGAATAAGCGTAGTCTCTTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-1024s21c1
Sequence:CCGGATAGCAGTTCTTGGGTATTTACTCGAGTAAATACCCAAGAACTGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-1345s21c1
Sequence:CCGGCCCGTGATCTTTCCTAAACAACTCGAGTTGTTTAGGAAAGATCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-1345s1c1
Sequence:CCGGCCCGTGATCTTTCCTAAACAACTCGAGTTGTTTAGGAAAGATCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-3852s21c1
Sequence:CCGGGACTGGCTAGTCCAGCGTTTACTCGAGTAAACGCTGGACTAGCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008396.2-2274s1c1
Sequence:CCGGGCAGAAGAATATGGTGGTAAACTCGAGTTTACCACCATATTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-733s1c1
Sequence:CCGGGCGTTAATTCAATATGCCAATCTCGAGATTGGCATATTGAATTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-145s1c1
Sequence:CCGGCGGCTGCTAATGCTAGTTCAACTCGAGTTGAACTAGCATTAGCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-2521s1c1
Sequence:CCGGGCCATTCAAACTCAATCCTTTCTCGAGAAAGGATTGAGTTTGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008396
VALIDATED
ITGA2 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-145s21c1
Sequence:CCGGCGGCTGCTAATGCTAGTTCAACTCGAGTTGAACTAGCATTAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-872s21c1
Sequence:CCGGTCGCAAGAGACTACGCTTATTCTCGAGAATAAGCGTAGTCTCTTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-1024s21c1
Sequence:CCGGATAGCAGTTCTTGGGTATTTACTCGAGTAAATACCCAAGAACTGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-1345s21c1
Sequence:CCGGCCCGTGATCTTTCCTAAACAACTCGAGTTGTTTAGGAAAGATCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-1345s1c1
Sequence:CCGGCCCGTGATCTTTCCTAAACAACTCGAGTTGTTTAGGAAAGATCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-3852s21c1
Sequence:CCGGGACTGGCTAGTCCAGCGTTTACTCGAGTAAACGCTGGACTAGCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008396.2-2274s1c1
Sequence:CCGGGCAGAAGAATATGGTGGTAAACTCGAGTTTACCACCATATTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-733s1c1
Sequence:CCGGGCGTTAATTCAATATGCCAATCTCGAGATTGGCATATTGAATTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-145s1c1
Sequence:CCGGCGGCTGCTAATGCTAGTTCAACTCGAGTTGAACTAGCATTAGCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-2521s1c1
Sequence:CCGGGCCATTCAAACTCAATCCTTTCTCGAGAAAGGATTGAGTTTGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008396
VALIDATED
ITGA2 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-145s21c1
Sequence:CCGGCGGCTGCTAATGCTAGTTCAACTCGAGTTGAACTAGCATTAGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-872s21c1
Sequence:CCGGTCGCAAGAGACTACGCTTATTCTCGAGAATAAGCGTAGTCTCTTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-1024s21c1
Sequence:CCGGATAGCAGTTCTTGGGTATTTACTCGAGTAAATACCCAAGAACTGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-1345s21c1
Sequence:CCGGCCCGTGATCTTTCCTAAACAACTCGAGTTGTTTAGGAAAGATCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-1345s1c1
Sequence:CCGGCCCGTGATCTTTCCTAAACAACTCGAGTTGTTTAGGAAAGATCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008396.2-3852s21c1
Sequence:CCGGGACTGGCTAGTCCAGCGTTTACTCGAGTAAACGCTGGACTAGCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008396.2-2274s1c1
Sequence:CCGGGCAGAAGAATATGGTGGTAAACTCGAGTTTACCACCATATTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-733s1c1
Sequence:CCGGGCGTTAATTCAATATGCCAATCTCGAGATTGGCATATTGAATTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-145s1c1
Sequence:CCGGCGGCTGCTAATGCTAGTTCAACTCGAGTTGAACTAGCATTAGCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008396.2-2521s1c1
Sequence:CCGGGCCATTCAAACTCAATCCTTTCTCGAGAAAGGATTGAGTTTGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002203
VALIDATED
ITGA2 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002203.3-266s21c1
Sequence:CCGGCGGTCCTTCAAGTGAACAGTTCTCGAGAACTGTTCACTTGAAGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002203.3-1561s21c1
Sequence:CCGGATGGCAATATCACGGTTATTCCTCGAGGAATAACCGTGATATTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002203.3-3795s21c1
Sequence:CCGGAGGTAAACTAACCTGGTATTTCTCGAGAAATACCAGGTTAGTTTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002203.3-1505s21c1
Sequence:CCGGTGGTGCTCCTCGGGCAAATTACTCGAGTAATTTGCCCGAGGAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002203.3-1528s21c1
Sequence:CCGGCCGGCCAGATAGTGCTATATACTCGAGTATATAGCACTATCTGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-165s1c1
Sequence:CCGGCGGTCCTTCAAGTGAACAGTTCTCGAGAACTGTTCACTTGAAGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002203.2-1427s1c1
Sequence:CCGGCCGGCCAGATAGTGCTATATACTCGAGTATATAGCACTATCTGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-2833s1c1
Sequence:CCGGCCTCTCCTGTATGATGCTGAACTCGAGTTCAGCATCATACAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-3082s1c1
Sequence:CCGGGCTGGTGACATCAGTTGTAATCTCGAGATTACAACTGATGTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-1830s1c1
Sequence:CCGGCCGCACAAAGTATTCCCAGAACTCGAGTTCTGGGAATACTTTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002203
VALIDATED
ITGA2 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002203.3-266s21c1
Sequence:CCGGCGGTCCTTCAAGTGAACAGTTCTCGAGAACTGTTCACTTGAAGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002203.3-1561s21c1
Sequence:CCGGATGGCAATATCACGGTTATTCCTCGAGGAATAACCGTGATATTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002203.3-3795s21c1
Sequence:CCGGAGGTAAACTAACCTGGTATTTCTCGAGAAATACCAGGTTAGTTTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002203.3-1505s21c1
Sequence:CCGGTGGTGCTCCTCGGGCAAATTACTCGAGTAATTTGCCCGAGGAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002203.3-1528s21c1
Sequence:CCGGCCGGCCAGATAGTGCTATATACTCGAGTATATAGCACTATCTGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-165s1c1
Sequence:CCGGCGGTCCTTCAAGTGAACAGTTCTCGAGAACTGTTCACTTGAAGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002203.2-1427s1c1
Sequence:CCGGCCGGCCAGATAGTGCTATATACTCGAGTATATAGCACTATCTGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-2833s1c1
Sequence:CCGGCCTCTCCTGTATGATGCTGAACTCGAGTTCAGCATCATACAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-3082s1c1
Sequence:CCGGGCTGGTGACATCAGTTGTAATCTCGAGATTACAACTGATGTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-1830s1c1
Sequence:CCGGCCGCACAAAGTATTCCCAGAACTCGAGTTCTGGGAATACTTTGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002203
VALIDATED
ITGA2 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002203.3-266s21c1
Sequence:CCGGCGGTCCTTCAAGTGAACAGTTCTCGAGAACTGTTCACTTGAAGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002203.3-1561s21c1
Sequence:CCGGATGGCAATATCACGGTTATTCCTCGAGGAATAACCGTGATATTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002203.3-3795s21c1
Sequence:CCGGAGGTAAACTAACCTGGTATTTCTCGAGAAATACCAGGTTAGTTTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002203.3-1505s21c1
Sequence:CCGGTGGTGCTCCTCGGGCAAATTACTCGAGTAATTTGCCCGAGGAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002203.3-1528s21c1
Sequence:CCGGCCGGCCAGATAGTGCTATATACTCGAGTATATAGCACTATCTGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-165s1c1
Sequence:CCGGCGGTCCTTCAAGTGAACAGTTCTCGAGAACTGTTCACTTGAAGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002203.2-1427s1c1
Sequence:CCGGCCGGCCAGATAGTGCTATATACTCGAGTATATAGCACTATCTGGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-2833s1c1
Sequence:CCGGCCTCTCCTGTATGATGCTGAACTCGAGTTCAGCATCATACAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-3082s1c1
Sequence:CCGGGCTGGTGACATCAGTTGTAATCTCGAGATTACAACTGATGTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002203.2-1830s1c1
Sequence:CCGGCCGCACAAAGTATTCCCAGAACTCGAGTTCTGGGAATACTTTGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)