EMAIL THIS PAGE TO A FRIEND

ITGA2B

integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)

140 Gene Product Result for
Synonyms: BDPLT16 BDPLT2 CD41 CD41B GP2B GPIIb GT GTA HPA3
UniProtKB ID: P08514, B2RCY8, O95366, Q14443, Q17R67
Gene ID:
Human(3674) Summary: ITGA2B encodes integrin alpha chain 2b. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. Alpha chain 2b undergoes post-translational cleavage to yield disulfide-linked light and heavy chains that join with beta 3 to form a fibronectin receptor expressed in platelets that plays a crucial role in coagulation. Mutations that interfere with this role result in thrombasthenia. In addition to adhesion, integrins are known to participate in cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
Mouse(16399) integrin alpha 2b
Rat(685269) integrin, alpha 2B
Zebrafish(445380) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)
dog(403789) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
domestic cat(101100930) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
cow(515011) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Horse(100009697) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
sheep(101115719) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
domestic guinea pig(100727374) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
naked mole-rat(101714332) integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
I9660 Anti-Integrin α2b (CD41) antibody, Mouse monoclonal clone PM6/248, purified from hybridoma cell culture baboon, human
flow cytometry, immunoprecipitation (IP) pricing
HPA031168 Anti-ITGA2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA031169 Anti-ITGA2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
HPA031170 Anti-ITGA2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA031171 Anti-ITGA2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4700369 Monoclonal Anti-CD41 antibody produced in mouse clone MEM-06, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700370 Monoclonal Anti-CD41-APC antibody produced in mouse clone MEM-06, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700371 Monoclonal Anti-CD41-Biotin antibody produced in mouse clone MEM-06, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700372 Monoclonal Anti-CD41-FITC antibody produced in mouse clone MEM-06, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700373 Monoclonal Anti-CD41-PE antibody produced in mouse clone MEM-06, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700374 Monoclonal Anti-CD41a antibody produced in mouse clone HIP8, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700375 Monoclonal Anti-CD41b antibody produced in mouse clone HIP2, purified immunoglobulin, buffered aqueous solution nonhuman primates, human
flow cytometry pricing
SAB4700641 Monoclonal Anti-ITGA2B antibody produced in mouse clone IVA30, purified immunoglobulin, buffered aqueous solution bovine
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000419 Rosetta Predictions human pricing
XM_001063315 Rosetta Predictions rat pricing
NM_010575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075094 predicted 859
2 SASI_Hs01_00075095 predicted 807
3 SASI_Hs01_00075096 predicted 1772
4 SASI_Hs01_00075097 predicted 1605
5 SASI_Hs01_00075098 predicted 991
6 SASI_Hs01_00075099 predicted 2093
7 SASI_Hs01_00075100 predicted 2317
8 SASI_Hs01_00075101 predicted 2201
9 SASI_Hs01_00075102 predicted 2616
10 SASI_Hs01_00075103 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306650 predicted 280
2 SASI_Rn02_00306651 predicted 1203
3 SASI_Rn02_00306652 predicted 1226
4 SASI_Rn02_00306653 predicted 518
5 SASI_Rn02_00306654 predicted 1390
6 SASI_Rn02_00306655 predicted 1281
7 SASI_Rn02_00306656 predicted 1547
8 SASI_Rn02_00306657 predicted 1324
9 SASI_Rn02_00306658 predicted 1340
10 SASI_Rn02_00306659 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165484 predicted 2606
2 SASI_Mm01_00165486 predicted 1096
3 SASI_Mm02_00318849 predicted 2629
4 SASI_Mm01_00165488 predicted 1874
5 SASI_Mm02_00318850 predicted 2769
6 SASI_Mm02_00318851 predicted 319
7 SASI_Mm02_00318852 predicted 327
8 SASI_Mm02_00318853 predicted 277
9 SASI_Mm02_00318854 predicted 282
10 SASI_Mm01_00165490 predicted 1421
11 SASI_Mm01_00165483 predicted 352
12 SASI_Mm01_00165485 predicted 1988
13 SASI_Mm01_00165487 predicted 1420
14 SASI_Mm01_00165489 predicted 1815
15 SASI_Mm01_00165491 predicted 2313
16 SASI_Mm01_00165492 predicted 2110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000419
VALIDATED
ITGA2B MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-340s21c1
Sequence:CCGGTCCGTGATGAGACCCGAAATGCTCGAGCATTTCGGGTCTCATCACGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-2130s21c1
Sequence:CCGGTTTGAGAGACTCATCTGTAATCTCGAGATTACAGATGAGTCTCTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-715s21c1
Sequence:CCGGAGGCTCCAGTTGCGGATATTTCTCGAGAAATATCCGCAACTGGAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-1173s21c1
Sequence:CCGGACACAGCTCTATGGGCGATTCCTCGAGGAATCGCCCATAGAGCTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-1394s21c1
Sequence:CCGGTGCCGTAGACATCGATGACAACTCGAGTTGTCATCGATGTCTACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-2216s21c1
Sequence:CCGGCCAGATAGGAATCGCGATGTTCTCGAGAACATCGCGATTCCTATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-681s1c1
Sequence:CCGGCCTGGCGGCTATTATTTCTTACTCGAGTAAGAAATAATAGCCGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000419.2-2559s1c1
Sequence:CCGGCTGCTCTACATCCTGGATATACTCGAGTATATCCAGGATGTAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-368s1c1
Sequence:CCGGCCAAACTTTACAAACCTTCAACTCGAGTTGAAGGTTTGTAAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000419.2-1620s1c1
Sequence:CCGGCCTCAGAAGCTATCCCTAAATCTCGAGATTTAGGGATAGCTTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-1506s1c1
Sequence:CCGGCTGGTGCAAGATTCACTGAATCTCGAGATTCAGTGAATCTTGCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000419
VALIDATED
ITGA2B MISSION shRNA shRNA Plasmid DNA
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-340s21c1
Sequence:CCGGTCCGTGATGAGACCCGAAATGCTCGAGCATTTCGGGTCTCATCACGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-2130s21c1
Sequence:CCGGTTTGAGAGACTCATCTGTAATCTCGAGATTACAGATGAGTCTCTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-715s21c1
Sequence:CCGGAGGCTCCAGTTGCGGATATTTCTCGAGAAATATCCGCAACTGGAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-1173s21c1
Sequence:CCGGACACAGCTCTATGGGCGATTCCTCGAGGAATCGCCCATAGAGCTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-1394s21c1
Sequence:CCGGTGCCGTAGACATCGATGACAACTCGAGTTGTCATCGATGTCTACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-2216s21c1
Sequence:CCGGCCAGATAGGAATCGCGATGTTCTCGAGAACATCGCGATTCCTATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-681s1c1
Sequence:CCGGCCTGGCGGCTATTATTTCTTACTCGAGTAAGAAATAATAGCCGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000419.2-2559s1c1
Sequence:CCGGCTGCTCTACATCCTGGATATACTCGAGTATATCCAGGATGTAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-368s1c1
Sequence:CCGGCCAAACTTTACAAACCTTCAACTCGAGTTGAAGGTTTGTAAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000419.2-1620s1c1
Sequence:CCGGCCTCAGAAGCTATCCCTAAATCTCGAGATTTAGGGATAGCTTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-1506s1c1
Sequence:CCGGCTGGTGCAAGATTCACTGAATCTCGAGATTCAGTGAATCTTGCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000419
VALIDATED
ITGA2B MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-340s21c1
Sequence:CCGGTCCGTGATGAGACCCGAAATGCTCGAGCATTTCGGGTCTCATCACGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-2130s21c1
Sequence:CCGGTTTGAGAGACTCATCTGTAATCTCGAGATTACAGATGAGTCTCTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-715s21c1
Sequence:CCGGAGGCTCCAGTTGCGGATATTTCTCGAGAAATATCCGCAACTGGAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-1173s21c1
Sequence:CCGGACACAGCTCTATGGGCGATTCCTCGAGGAATCGCCCATAGAGCTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-1394s21c1
Sequence:CCGGTGCCGTAGACATCGATGACAACTCGAGTTGTCATCGATGTCTACGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000419.3-2216s21c1
Sequence:CCGGCCAGATAGGAATCGCGATGTTCTCGAGAACATCGCGATTCCTATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-681s1c1
Sequence:CCGGCCTGGCGGCTATTATTTCTTACTCGAGTAAGAAATAATAGCCGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000419.2-2559s1c1
Sequence:CCGGCTGCTCTACATCCTGGATATACTCGAGTATATCCAGGATGTAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-368s1c1
Sequence:CCGGCCAAACTTTACAAACCTTCAACTCGAGTTGAAGGTTTGTAAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000419.2-1620s1c1
Sequence:CCGGCCTCAGAAGCTATCCCTAAATCTCGAGATTTAGGGATAGCTTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000419.2-1506s1c1
Sequence:CCGGCTGGTGCAAGATTCACTGAATCTCGAGATTCAGTGAATCTTGCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010575
ITGA2B MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1224s1c1
Sequence:CCGGCGAGACGGCTATAATGATATTCTCGAGAATATCATTATAGCCGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-192s1c1
Sequence:CCGGGTGGACTTTCATAAGGACAAACTCGAGTTTGTCCTTATGAAAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1422s1c1
Sequence:CCGGGACCTGATTGTGGGAGCATATCTCGAGATATGCTCCCACAATCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-865s1c1
Sequence:CCGGCGAGCACTACAGAGTACGTATCTCGAGATACGTACTCTGTAGTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1870s1c1
Sequence:CCGGCCGTGGTATTGCATGGAGAAACTCGAGTTTCTCCATGCAATACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010575
ITGA2B MISSION shRNA shRNA Plasmid DNA
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1224s1c1
Sequence:CCGGCGAGACGGCTATAATGATATTCTCGAGAATATCATTATAGCCGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-192s1c1
Sequence:CCGGGTGGACTTTCATAAGGACAAACTCGAGTTTGTCCTTATGAAAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1422s1c1
Sequence:CCGGGACCTGATTGTGGGAGCATATCTCGAGATATGCTCCCACAATCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-865s1c1
Sequence:CCGGCGAGCACTACAGAGTACGTATCTCGAGATACGTACTCTGTAGTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1870s1c1
Sequence:CCGGCCGTGGTATTGCATGGAGAAACTCGAGTTTCTCCATGCAATACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010575
ITGA2B MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1224s1c1
Sequence:CCGGCGAGACGGCTATAATGATATTCTCGAGAATATCATTATAGCCGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-192s1c1
Sequence:CCGGGTGGACTTTCATAAGGACAAACTCGAGTTTGTCCTTATGAAAGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1422s1c1
Sequence:CCGGGACCTGATTGTGGGAGCATATCTCGAGATATGCTCCCACAATCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-865s1c1
Sequence:CCGGCGAGCACTACAGAGTACGTATCTCGAGATACGTACTCTGTAGTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010575.1-1870s1c1
Sequence:CCGGCCGTGGTATTGCATGGAGAAACTCGAGTTTCTCCATGCAATACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)