EMAIL THIS PAGE TO A FRIEND

ITGA4

integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)

73 Gene Product Result for
Synonyms: CD49D IA4
UniProtKB ID: P13612, D3DPG4
Gene ID:
Human(3676) Summary: The product of this gene belongs to the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an alpha 4 chain. Unlike other integrin alpha chains, alpha 4 neither contains an I-domain, nor undergoes disulfide-linked cleavage. Alpha 4 chain associates with either beta 1 chain or beta 7 chain. [provided by RefSeq, Jul 2008]
Mouse(16401) integrin alpha 4
Rat(311144) integrin, alpha 4
Zebrafish(100331333) integrin alpha 4
cow(282882) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Horse(100067886) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
domestic cat(101081745) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
dog(488429) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
chicken(424121) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
sheep(443499) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Domestic Rabbit(100346103) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
domestic guinea pig(100718628) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
naked mole-rat(101709723) integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4783 Anti-Integrin α4 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
PRS4827 Anti-Integrin α4 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, western blot pricing
PRS4837 Anti-Integrin α4 (ab3) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4501577 Anti-Integrin α4 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
I8285 Anti-ITGA4 (1024-1038) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2900216 Anti-ITGA4 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, monkey, rat, human
immunohistochemistry pricing
SAB2900217 Anti-ITGA4 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rabbit, mouse, human, monkey, pig, rat, hamster, dog
immunohistochemistry pricing
HPA074961 Anti-ITGA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA064041 Anti-ITGA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0003676M1 Monoclonal Anti-ITGA4 antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1403994 Monoclonal Anti-ITGA4 antibody produced in mouse clone 2G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098451 MISSION® esiRNA esiRNA human ITGA4 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MAB1383 Anti-Integrin α4 Antibody, clone HP2/1 Detect Integrin α4 using this Anti-Integrin α4 Antibody, clone HP2/1 validated for use in FC, IP, IH. pricing
MAB16983 Anti-Integrin α4 Antibody, clone P1H4 Anti-Integrin α4 Antibody, clone P1H4 detects level of Integrin α4 & has been published & validated for use in ELISA, FC, IP, IC, IH. pricing
MAB1955 Anti-Integrin α4 Antibody, clone P4C2 This Anti-Integrin α4 Antibody, clone P4C2 is validated for use in IP, IH, FUNC for the detection of Integrin α4. pricing
MAB1954 Anti-Integrin α4 Antibody, clone P4G9 Detect Integrin α4 using this Anti-Integrin α4 Antibody, clone P4G9 validated for use in IH. pricing
CBL1304 Anti-Integrin α4 Antibody, clone PS/2 Anti-Integrin α4 Antibody, clone PS/2 detects level of Integrin α4 & has been published & validated for use in FC, IF, IP, IH. pricing
AB1924 Anti-Integrin α4 Antibody, cytoplasmic on CT Anti-Integrin α4 Antibody, cytoplasmic on C-terminus is an antibody against Integrin α4 for use in ELISA, IP, RIA, WB, IH. pricing
AB1919 Anti-Integrin α4 Antibody, PhosphoSerine 988 This Anti-Integrin α4 Antibody, PhosphoSerine 988 is validated for use in ELISA, IP, WB for the detection of Integrin α4. pricing
MABF950 Anti-Integrin alpha-4 (CD49d) Antibody, clone TA-2 This mouse monoclonal Anti-Integrin alpha-4 (CD49d), clone TA-2, Cat. No. MABF950 is tested for use in Flow Cytometry, Immunoprecipitation, and in functional studies as Agonist or Inhibitor for the detection of CD49d/Integrin alpha-4. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000885 Rosetta Predictions human pricing
NM_001107737 Rosetta Predictions rat pricing
NM_010576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303430 predicted 3147
2 SASI_Hs01_00034756 predicted 3175
3 SASI_Hs01_00034757 predicted 2774
4 SASI_Hs02_00303431 predicted 2033
5 SASI_Hs01_00034758 predicted 2515
6 SASI_Hs01_00034760 predicted 3570
7 SASI_Hs02_00303432 predicted 1302
8 SASI_Hs01_00034762 predicted 2086
9 SASI_Hs01_00034763 predicted 2044
10 SASI_Hs02_00303433 predicted 3844
11 SASI_Hs01_00034754 predicted 3019
12 SASI_Hs01_00034755 predicted 2924
13 SASI_Hs01_00034759 predicted 2603
14 SASI_Hs01_00034761 predicted 1844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231775 predicted 3341
2 SASI_Rn02_00231776 predicted 1567
3 SASI_Rn02_00231777 predicted 828
4 SASI_Rn02_00231778 predicted 1638
5 SASI_Rn02_00231779 predicted 2915
6 SASI_Rn02_00231780 predicted 340
7 SASI_Rn02_00231781 predicted 1494
8 SASI_Rn02_00231782 predicted 1098
9 SASI_Rn02_00231783 predicted 1329
10 SASI_Rn02_00231784 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113010 predicted 2185
2 SASI_Mm01_00113011 predicted 2077
3 SASI_Mm02_00318855 predicted 1869
4 SASI_Mm01_00113014 predicted 1559
5 SASI_Mm01_00113012 predicted 490
6 SASI_Mm02_00318856 predicted 323
7 SASI_Mm01_00113015 predicted 1494
8 SASI_Mm01_00113016 predicted 3189
9 SASI_Mm01_00113017 predicted 2794
10 SASI_Mm01_00113018 predicted 1517
11 SASI_Mm01_00113013 predicted 2805
12 SASI_Mm01_00113019 predicted 1758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000885
VALIDATED
ITGA4 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-2194s21c1
Sequence:CCGGGTCAGTAAATAGAACGAAATTCTCGAGAATTTCGTTCTATTTACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-4039s21c1
Sequence:CCGGGAAGAACTGCAAAGGTAATAACTCGAGTTATTACCTTTGCAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-2432s21c1
Sequence:CCGGTGTAGAACACATCAAGCATTTCTCGAGAAATGCTTGATGTGTTCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-996s21c1
Sequence:CCCGCCAACGCTTCAGTGATCAATCCTCGAGGATTGATCACTGAAGCGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-3971s21c1
Sequence:CCGGCATGATCTTGTGACATATTATCTCGAGATAATATGTCACAAGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-1945s21c1
Sequence:CCGGTGACTTGCAAGGTGCTATTTACTCGAGTAAATAGCACCTTGCAAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-1878s21c1
Sequence:CCGGTAGTTAATCTTGGCGACATTGCTCGAGCAATGTCGCCAAGATTAACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-3892s21c1
Sequence:CCGGACAGACTCAGGTTGTAGTAAACTCGAGTTTACTACAACCTGAGTCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-1710s1c1
Sequence:CCGGGCTCCGTGTTATCAAGATTATCTCGAGATAATCTTGATAACACGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-3207s1c1
Sequence:CCGGCCCGTGGGTCTTTATTTCATTCTCGAGAATGAAATAAAGACCCACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000885.2-3624s1c1
Sequence:CCGGGCTCCCAATGTTAGTGTGGAACTCGAGTTCCACACTAACATTGGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-2209s1c1
Sequence:CCGGCGGGAGCAGTAATGAATGCAACTCGAGTTGCATTCATTACTGCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-3671s1c1
Sequence:CCGGCCAAACTGATAAGCTGTTCAACTCGAGTTGAACAGCTTATCAGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000885
VALIDATED
ITGA4 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-2194s21c1
Sequence:CCGGGTCAGTAAATAGAACGAAATTCTCGAGAATTTCGTTCTATTTACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-4039s21c1
Sequence:CCGGGAAGAACTGCAAAGGTAATAACTCGAGTTATTACCTTTGCAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-2432s21c1
Sequence:CCGGTGTAGAACACATCAAGCATTTCTCGAGAAATGCTTGATGTGTTCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-996s21c1
Sequence:CCCGCCAACGCTTCAGTGATCAATCCTCGAGGATTGATCACTGAAGCGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-3971s21c1
Sequence:CCGGCATGATCTTGTGACATATTATCTCGAGATAATATGTCACAAGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-1945s21c1
Sequence:CCGGTGACTTGCAAGGTGCTATTTACTCGAGTAAATAGCACCTTGCAAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-1878s21c1
Sequence:CCGGTAGTTAATCTTGGCGACATTGCTCGAGCAATGTCGCCAAGATTAACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-3892s21c1
Sequence:CCGGACAGACTCAGGTTGTAGTAAACTCGAGTTTACTACAACCTGAGTCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-1710s1c1
Sequence:CCGGGCTCCGTGTTATCAAGATTATCTCGAGATAATCTTGATAACACGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-3207s1c1
Sequence:CCGGCCCGTGGGTCTTTATTTCATTCTCGAGAATGAAATAAAGACCCACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000885.2-3624s1c1
Sequence:CCGGGCTCCCAATGTTAGTGTGGAACTCGAGTTCCACACTAACATTGGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-2209s1c1
Sequence:CCGGCGGGAGCAGTAATGAATGCAACTCGAGTTGCATTCATTACTGCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-3671s1c1
Sequence:CCGGCCAAACTGATAAGCTGTTCAACTCGAGTTGAACAGCTTATCAGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000885
VALIDATED
ITGA4 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-2194s21c1
Sequence:CCGGGTCAGTAAATAGAACGAAATTCTCGAGAATTTCGTTCTATTTACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-4039s21c1
Sequence:CCGGGAAGAACTGCAAAGGTAATAACTCGAGTTATTACCTTTGCAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-2432s21c1
Sequence:CCGGTGTAGAACACATCAAGCATTTCTCGAGAAATGCTTGATGTGTTCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-996s21c1
Sequence:CCCGCCAACGCTTCAGTGATCAATCCTCGAGGATTGATCACTGAAGCGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-3971s21c1
Sequence:CCGGCATGATCTTGTGACATATTATCTCGAGATAATATGTCACAAGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-1945s21c1
Sequence:CCGGTGACTTGCAAGGTGCTATTTACTCGAGTAAATAGCACCTTGCAAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000885.4-1878s21c1
Sequence:CCGGTAGTTAATCTTGGCGACATTGCTCGAGCAATGTCGCCAAGATTAACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000885.4-3892s21c1
Sequence:CCGGACAGACTCAGGTTGTAGTAAACTCGAGTTTACTACAACCTGAGTCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-1710s1c1
Sequence:CCGGGCTCCGTGTTATCAAGATTATCTCGAGATAATCTTGATAACACGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-3207s1c1
Sequence:CCGGCCCGTGGGTCTTTATTTCATTCTCGAGAATGAAATAAAGACCCACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000885.2-3624s1c1
Sequence:CCGGGCTCCCAATGTTAGTGTGGAACTCGAGTTCCACACTAACATTGGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-2209s1c1
Sequence:CCGGCGGGAGCAGTAATGAATGCAACTCGAGTTGCATTCATTACTGCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000885.2-3671s1c1
Sequence:CCGGCCAAACTGATAAGCTGTTCAACTCGAGTTGAACAGCTTATCAGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010576
ITGA4 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010576.2-3383s1c1
Sequence:CCGGGCCGACTTAAAGGGAATGATTCTCGAGAATCATTCCCTTTAAGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-1333s1c1
Sequence:CCGGGCAGACAACAATGGATATGTTCTCGAGAACATATCCATTGTTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-520s1c1
Sequence:CCGGCCTTCTGATTTGCGGACAGAACTCGAGTTCTGTCCGCAAATCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-2470s1c1
Sequence:CCGGGCTCCAAATGTTAGTGTGAAACTCGAGTTTCACACTAACATTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-683s1c1
Sequence:CCGGGCACCGTCTTTGTCTACAATACTCGAGTATTGTAGACAAAGACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010576
ITGA4 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010576.2-3383s1c1
Sequence:CCGGGCCGACTTAAAGGGAATGATTCTCGAGAATCATTCCCTTTAAGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-1333s1c1
Sequence:CCGGGCAGACAACAATGGATATGTTCTCGAGAACATATCCATTGTTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-520s1c1
Sequence:CCGGCCTTCTGATTTGCGGACAGAACTCGAGTTCTGTCCGCAAATCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-2470s1c1
Sequence:CCGGGCTCCAAATGTTAGTGTGAAACTCGAGTTTCACACTAACATTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-683s1c1
Sequence:CCGGGCACCGTCTTTGTCTACAATACTCGAGTATTGTAGACAAAGACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010576
ITGA4 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010576.2-3383s1c1
Sequence:CCGGGCCGACTTAAAGGGAATGATTCTCGAGAATCATTCCCTTTAAGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-1333s1c1
Sequence:CCGGGCAGACAACAATGGATATGTTCTCGAGAACATATCCATTGTTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-520s1c1
Sequence:CCGGCCTTCTGATTTGCGGACAGAACTCGAGTTCTGTCCGCAAATCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-2470s1c1
Sequence:CCGGGCTCCAAATGTTAGTGTGAAACTCGAGTTTCACACTAACATTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010576.2-683s1c1
Sequence:CCGGGCACCGTCTTTGTCTACAATACTCGAGTATTGTAGACAAAGACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)