EMAIL THIS PAGE TO A FRIEND

ITGA5

integrin, alpha 5 (fibronectin receptor, alpha polypeptide)

163 Gene Product Result for
Synonyms: CD49e FNRA VLA5A
UniProtKB ID: P08648, Q96HA5
Gene ID:
Human(3678) Summary: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain. Alpha chain 5 undergoes post-translational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
Mouse(16402) integrin alpha 5 (fibronectin receptor alpha)
Rat(315346) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
domestic guinea pig(100725679) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
naked mole-rat(101714885) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
sheep(443140) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Domestic Rabbit(100009172) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Zebrafish(386787) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
cow(281873) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Horse(100064655) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
domestic cat(101093870) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
dog(486493) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
chicken(378932) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002205 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ECM410 α5β1 Integrin Investigator Kit pricing
CBL497 Anti-CD49e Antibody, clone SAM-1 Anti-CD49e Antibody, clone SAM-1 is an antibody against CD49e for use in FC & IF. pricing
MAB1984-I Anti-Integrin α5β1 Antibody, clone BMA5 This Anti-Integrin α5β1 Antibody, clone BMA5 is validated for use in Flow Cytometry, Immunoprecipitation, Affects Function for the detection of Integrin α5β1. pricing
MAB2514 Anti-Integrin α5β1 Antibody, clone BMB5 This Anti-Integrin α5β1 Antibody, clone BMB5 is validated for use in FC, IP, WB, IH, FUNC for the detection of Integrin α5β1. pricing
MAB2575 Anti-Integrin α5β1 Antibody, clone BMC5 Detect Integrin α5β1 using this Anti-Integrin α5β1 Antibody, clone BMC5 validated for use in FC, IP, IH. pricing
MAB1999 Anti-Integrin α5β1 Antibody, clone HA5 Anti-Integrin α5β1 Antibody, clone HA5 detects level of Integrin α5β1 & has been published & validated for use in FC & IP. pricing
MAB1969 Anti-Integrin α5β1 Antibody, clone JBS5 Anti-Integrin α5β1 Antibody, clone JBS5 is an antibody against Integrin α5β1 for use in IH, IH(P) & IP. pricing
AB1921 Anti-Integrin α5 Antibody Detect Integrin α5 using this Anti-Integrin α5 Antibody validated for use in ELISA, WB, IH. pricing
AB1949 Anti-Integrin α5 Antibody Anti-Integrin α5 Antibody detects level of Integrin α5 & has been published & validated for use in IP & WB. pricing
MAB1956 Anti-Integrin α5 Antibody, clone P1D6 Anti-Integrin α5 Antibody, clone P1D6 is an antibody against Integrin α5 for use in IH. pricing
MAB1956Z Anti-Integrin α5 Antibody, clone P1D6, azide free This Anti-Integrin α5 Antibody, clone P1D6, azide free is validated for use in IH, FUNC for the detection of Integrin α5. pricing
CBL497P Anti-Integrin α5 Antibody, clone SAM-1, Phycoerythrin conjugated Detect Integrin α5 using this Anti-Integrin α5 Antibody, clone SAM-1, Phycoerythrin conjugated validated for use in FC. pricing
AB1928 Anti-Integrin α5 Antibody, CT, Intracellular Anti-Integrin α5 Antibody, C-terminus, Intracellular detects level of Integrin α5 & has been published & validated for use in ELISA, IC, IF, IH, IP, RIA & WB. pricing
MABT18 Anti-Integrin alpha5 (CD49e) Antibody, clone MFR5 (5H10-27) This Anti-Integrin alpha5 (CD49e) Antibody, clone MFR5 (5H10-27) is validated for use in FC for the detection of Integrin alpha5 (CD49e). pricing
CC102D Human Integrin α5β1, Octyl-β-D-glucopyranoside Formulation pricing
CC105 Human Integrin α5β1 Protein, Triton X-100 Formulation pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002205 Rosetta Predictions human pricing
NM_001108118 Rosetta Predictions rat pricing
NM_010577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058581 predicted 603
2 SASI_Hs02_00333426 predicted 2093
3 SASI_Hs01_00058582 predicted 783
4 SASI_Hs01_00058583 predicted 1235
5 SASI_Hs01_00058584 predicted 1213
6 SASI_Hs01_00058586 predicted 623
7 SASI_Hs01_00058587 predicted 468
8 SASI_Hs01_00058589 predicted 2055
9 SASI_Hs01_00058590 predicted 619
10 SASI_Hs02_00333427 predicted 604
11 SASI_Hs01_00058585 predicted 957
12 SASI_Hs01_00058588 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235534 predicted 2043
2 SASI_Rn02_00235535 predicted 2577
3 SASI_Rn02_00235536 predicted 1220
4 SASI_Rn02_00235537 predicted 664
5 SASI_Rn02_00235538 predicted 1485
6 SASI_Rn02_00235539 predicted 2287
7 SASI_Rn02_00235540 predicted 1171
8 SASI_Rn02_00235541 predicted 768
9 SASI_Rn02_00235542 predicted 831
10 SASI_Rn02_00235543 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098103 predicted 1999
2 SASI_Mm01_00098104 predicted 2013
3 SASI_Mm01_00098105 predicted 1546
4 SASI_Mm01_00098106 predicted 641
5 SASI_Mm01_00098107 predicted 1145
6 SASI_Mm01_00098108 predicted 2556
7 SASI_Mm01_00098110 predicted 2264
8 SASI_Mm01_00098112 predicted 602
9 SASI_Mm02_00318857 predicted 747
10 SASI_Mm02_00318858 predicted 2113
11 SASI_Mm01_00098109 predicted 922
12 SASI_Mm01_00098111 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010577
VALIDATED
ITGA5 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3690s21c1
Sequence:CCGGATCAACTTGGAACCATAATTACTCGAGTAATTATGGTTCCAAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010577.2-1452s21c1
Sequence:CCGGTGGACCAAGACGGCTACAATGCTCGAGCATTGTAGCCGTCTTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3079s21c1
Sequence:CCGGGACCTTCTTGCAGCGGGAATACTCGAGTATTCCCGCTGCAAGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1651s21c1
Sequence:CCGGCAATGGATACCCTGATCTAATCTCGAGATTAGATCAGGGTATCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1506s21c1
Sequence:CCGGCCCAGCAGGGAGTCGTATTTACTCGAGTAAATACGACTCCCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2053s1c1
Sequence:CCGGCCCAATTCACATTGCCCTCAACTCGAGTTGAGGGCAATGTGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2548s1c1
Sequence:CCGGCCTCAGCAAGAACCTGAACAACTCGAGTTGTTCAGGTTCTTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1402s1c1
Sequence:CCGGGCAAGATGAGTTCAGCCGATTCTCGAGAATCGGCTGAACTCATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1159s1c1
Sequence:CCGGCGTCCTTAATGGCTCAGACATCTCGAGATGTCTGAGCCATTAAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-974s1c1
Sequence:CCGGGAGTCCTATTACCCAGAGTATCTCGAGATACTCTGGGTAATAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010577
VALIDATED
ITGA5 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3690s21c1
Sequence:CCGGATCAACTTGGAACCATAATTACTCGAGTAATTATGGTTCCAAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010577.2-1452s21c1
Sequence:CCGGTGGACCAAGACGGCTACAATGCTCGAGCATTGTAGCCGTCTTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3079s21c1
Sequence:CCGGGACCTTCTTGCAGCGGGAATACTCGAGTATTCCCGCTGCAAGAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1651s21c1
Sequence:CCGGCAATGGATACCCTGATCTAATCTCGAGATTAGATCAGGGTATCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1506s21c1
Sequence:CCGGCCCAGCAGGGAGTCGTATTTACTCGAGTAAATACGACTCCCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2053s1c1
Sequence:CCGGCCCAATTCACATTGCCCTCAACTCGAGTTGAGGGCAATGTGAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2548s1c1
Sequence:CCGGCCTCAGCAAGAACCTGAACAACTCGAGTTGTTCAGGTTCTTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1402s1c1
Sequence:CCGGGCAAGATGAGTTCAGCCGATTCTCGAGAATCGGCTGAACTCATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1159s1c1
Sequence:CCGGCGTCCTTAATGGCTCAGACATCTCGAGATGTCTGAGCCATTAAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-974s1c1
Sequence:CCGGGAGTCCTATTACCCAGAGTATCTCGAGATACTCTGGGTAATAGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010577
VALIDATED
ITGA5 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3690s21c1
Sequence:CCGGATCAACTTGGAACCATAATTACTCGAGTAATTATGGTTCCAAGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010577.2-1452s21c1
Sequence:CCGGTGGACCAAGACGGCTACAATGCTCGAGCATTGTAGCCGTCTTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3079s21c1
Sequence:CCGGGACCTTCTTGCAGCGGGAATACTCGAGTATTCCCGCTGCAAGAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1651s21c1
Sequence:CCGGCAATGGATACCCTGATCTAATCTCGAGATTAGATCAGGGTATCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1506s21c1
Sequence:CCGGCCCAGCAGGGAGTCGTATTTACTCGAGTAAATACGACTCCCTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2053s1c1
Sequence:CCGGCCCAATTCACATTGCCCTCAACTCGAGTTGAGGGCAATGTGAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2548s1c1
Sequence:CCGGCCTCAGCAAGAACCTGAACAACTCGAGTTGTTCAGGTTCTTGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1402s1c1
Sequence:CCGGGCAAGATGAGTTCAGCCGATTCTCGAGAATCGGCTGAACTCATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1159s1c1
Sequence:CCGGCGTCCTTAATGGCTCAGACATCTCGAGATGTCTGAGCCATTAAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-974s1c1
Sequence:CCGGGAGTCCTATTACCCAGAGTATCTCGAGATACTCTGGGTAATAGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002205
VALIDATED
ITGA5 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-732s21c1
Sequence:CCGGGGTGGACCAGGAAGCTATTTCCTCGAGGAAATAGCTTCCTGGTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1224s21c1
Sequence:CCGGCATGATGAGTTTGGCCGATTTCTCGAGAAATCGGCCAAACTCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002205.2-3900s21c1
Sequence:CCGGAGGCAGATCCAGGACTATATTCTCGAGAATATAGTCCTGGATCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1474s21c1
Sequence:GTACCGGATGGATATCCTGATCTGATTGCTCGAGCAATCAGATCAGGATATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1935s21c1
Sequence:CCGGCTCAGGCCAGCCCTACATTATCTCGAGATAATGTAGGGCTGGCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1178s1c1
Sequence:CCGGCCATGATGAGTTTGGCCGATTCTCGAGAATCGGCCAAACTCATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-559s1c1
Sequence:CCGGCCACAGATAACTTCACCCGAACTCGAGTTCGGGTGAAGTTATCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1793s1c1
Sequence:CCGGCCTCAGGAACGAGTCAGAATTCTCGAGAATTCTGACTCGTTCCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-3015s1c1
Sequence:CCGGCCACTGTGGATCATCATCCTACTCGAGTAGGATGATGATCCACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002205.1-2595s1c1
Sequence:CCGGCTCCTATATGTGACCAGAGTTCTCGAGAACTCTGGTCACATATAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002205
VALIDATED
ITGA5 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-732s21c1
Sequence:CCGGGGTGGACCAGGAAGCTATTTCCTCGAGGAAATAGCTTCCTGGTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1224s21c1
Sequence:CCGGCATGATGAGTTTGGCCGATTTCTCGAGAAATCGGCCAAACTCATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002205.2-3900s21c1
Sequence:CCGGAGGCAGATCCAGGACTATATTCTCGAGAATATAGTCCTGGATCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1474s21c1
Sequence:GTACCGGATGGATATCCTGATCTGATTGCTCGAGCAATCAGATCAGGATATCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1935s21c1
Sequence:CCGGCTCAGGCCAGCCCTACATTATCTCGAGATAATGTAGGGCTGGCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1178s1c1
Sequence:CCGGCCATGATGAGTTTGGCCGATTCTCGAGAATCGGCCAAACTCATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-559s1c1
Sequence:CCGGCCACAGATAACTTCACCCGAACTCGAGTTCGGGTGAAGTTATCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1793s1c1
Sequence:CCGGCCTCAGGAACGAGTCAGAATTCTCGAGAATTCTGACTCGTTCCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-3015s1c1
Sequence:CCGGCCACTGTGGATCATCATCCTACTCGAGTAGGATGATGATCCACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002205.1-2595s1c1
Sequence:CCGGCTCCTATATGTGACCAGAGTTCTCGAGAACTCTGGTCACATATAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002205
VALIDATED
ITGA5 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-732s21c1
Sequence:CCGGGGTGGACCAGGAAGCTATTTCCTCGAGGAAATAGCTTCCTGGTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1224s21c1
Sequence:CCGGCATGATGAGTTTGGCCGATTTCTCGAGAAATCGGCCAAACTCATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002205.2-3900s21c1
Sequence:CCGGAGGCAGATCCAGGACTATATTCTCGAGAATATAGTCCTGGATCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1474s21c1
Sequence:GTACCGGATGGATATCCTGATCTGATTGCTCGAGCAATCAGATCAGGATATCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1935s21c1
Sequence:CCGGCTCAGGCCAGCCCTACATTATCTCGAGATAATGTAGGGCTGGCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1178s1c1
Sequence:CCGGCCATGATGAGTTTGGCCGATTCTCGAGAATCGGCCAAACTCATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-559s1c1
Sequence:CCGGCCACAGATAACTTCACCCGAACTCGAGTTCGGGTGAAGTTATCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1793s1c1
Sequence:CCGGCCTCAGGAACGAGTCAGAATTCTCGAGAATTCTGACTCGTTCCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-3015s1c1
Sequence:CCGGCCACTGTGGATCATCATCCTACTCGAGTAGGATGATGATCCACAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002205.1-2595s1c1
Sequence:CCGGCTCCTATATGTGACCAGAGTTCTCGAGAACTCTGGTCACATATAGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)