EMAIL THIS PAGE TO A FRIEND

ITGA5

integrin, alpha 5 (fibronectin receptor, alpha polypeptide)

149 Gene Product Result for
Synonyms: CD49e FNRA VLA5A
UniProtKB ID: P08648, Q96HA5
Gene ID:
Human(3678) Summary: The product of this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes the integrin alpha 5 chain. Alpha chain 5 undergoes post-translational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that join with beta 1 to form a fibronectin receptor. In addition to adhesion, integrins are known to participate in cell-surface mediated signalling. [provided by RefSeq, Jul 2008]
Mouse(16402) integrin alpha 5 (fibronectin receptor alpha)
Rat(315346) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
domestic guinea pig(100725679) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
naked mole-rat(101714885) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
sheep(443140) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Domestic Rabbit(100009172) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Zebrafish(386787) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
cow(281873) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Horse(100064655) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
domestic cat(101093870) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
dog(486493) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
chicken(378932) integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306132 ANTI-CD49E(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
flow cytometry, western blot pricing
AB1921 Anti-Integrin α5 Antibody serum, clone, Chemicon® mouse
ELISA, immunohistochemistry, western blot pricing
MAB1956 Anti-Integrin α5 Antibody, clone P1D6 ascites fluid, clone P1D6, Chemicon® human
immunohistochemistry pricing
MAB1956Z Anti-Integrin α5 Antibody, clone P1D6, azide free clone P1D6, Chemicon®, from mouse human
immunohistochemistry pricing
AB1928 Anti-Integrin α5 Antibody, CT, Intracellular serum, clone, Chemicon® chicken, human, hamster, human, rat, rat, hamster, chicken, mouse, mouse
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), radioimmunoassay, western blot pricing
MAB2514 Anti-Integrin α5β1 Antibody, clone BMB5 ascites fluid, clone BMB5, Chemicon® mouse
flow cytometry, immunohistochemistry, immunoprecipitation (IP), western blot pricing
MAB2575 Anti-Integrin α5β1 Antibody, clone BMC5 ascites fluid, clone BMC5, Chemicon® mouse
flow cytometry, immunohistochemistry, immunoprecipitation (IP) pricing
MAB1999 Anti-Integrin α5β1 Antibody, clone HA5 clone HA5, Chemicon®, from mouse pig, human
flow cytometry, immunoprecipitation (IP) pricing
MAB1969 Anti-Integrin α5β1 Antibody, clone JBS5 ascites fluid, clone JBS5, Chemicon® monkey, human
immunohistochemistry, immunoprecipitation (IP) pricing
MABT18 Anti-Integrin alpha5 (CD49e) Antibody, clone MFR5 (5H10-27) clone MFR5 (5H10-27), from rat mouse
flow cytometry pricing
SAB4501578 Anti-ITGA5 (heavy chain, Cleaved-Phe42) antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4501579 Anti-ITGA5 (light chain, Cleaved-Glu895) antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA002642 Anti-ITGA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, human
immunohistochemistry, western blot pricing
AMAB91447 Monoclonal Anti-ITGA5 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL6940, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
AMAB91448 Monoclonal Anti-ITGA5 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL6945, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
AMAB91449 Monoclonal Anti-ITGA5 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL6951, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB5300076 Monoclonal Anti-ITGA5 antibody produced in mouse clone 10F6, ascites fluid human
ELISA, flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002205 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002205 Rosetta Predictions human pricing
NM_001108118 Rosetta Predictions rat pricing
NM_010577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058581 predicted 603
2 SASI_Hs02_00333426 predicted 2093
3 SASI_Hs01_00058582 predicted 783
4 SASI_Hs01_00058583 predicted 1235
5 SASI_Hs01_00058584 predicted 1213
6 SASI_Hs01_00058586 predicted 623
7 SASI_Hs01_00058587 predicted 468
8 SASI_Hs01_00058589 predicted 2055
9 SASI_Hs01_00058590 predicted 619
10 SASI_Hs02_00333427 predicted 604
11 SASI_Hs01_00058585 predicted 957
12 SASI_Hs01_00058588 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235534 predicted 2043
2 SASI_Rn02_00235535 predicted 2577
3 SASI_Rn02_00235536 predicted 1220
4 SASI_Rn02_00235537 predicted 664
5 SASI_Rn02_00235538 predicted 1485
6 SASI_Rn02_00235539 predicted 2287
7 SASI_Rn02_00235540 predicted 1171
8 SASI_Rn02_00235541 predicted 768
9 SASI_Rn02_00235542 predicted 831
10 SASI_Rn02_00235543 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098103 predicted 1999
2 SASI_Mm01_00098104 predicted 2013
3 SASI_Mm01_00098105 predicted 1546
4 SASI_Mm01_00098106 predicted 641
5 SASI_Mm01_00098107 predicted 1145
6 SASI_Mm01_00098108 predicted 2556
7 SASI_Mm01_00098110 predicted 2264
8 SASI_Mm01_00098112 predicted 602
9 SASI_Mm02_00318857 predicted 747
10 SASI_Mm02_00318858 predicted 2113
11 SASI_Mm01_00098109 predicted 922
12 SASI_Mm01_00098111 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010577
VALIDATED
ITGA5 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3690s21c1
Sequence:CCGGATCAACTTGGAACCATAATTACTCGAGTAATTATGGTTCCAAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010577.2-1452s21c1
Sequence:CCGGTGGACCAAGACGGCTACAATGCTCGAGCATTGTAGCCGTCTTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3079s21c1
Sequence:CCGGGACCTTCTTGCAGCGGGAATACTCGAGTATTCCCGCTGCAAGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1651s21c1
Sequence:CCGGCAATGGATACCCTGATCTAATCTCGAGATTAGATCAGGGTATCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1506s21c1
Sequence:CCGGCCCAGCAGGGAGTCGTATTTACTCGAGTAAATACGACTCCCTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2053s1c1
Sequence:CCGGCCCAATTCACATTGCCCTCAACTCGAGTTGAGGGCAATGTGAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2548s1c1
Sequence:CCGGCCTCAGCAAGAACCTGAACAACTCGAGTTGTTCAGGTTCTTGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1402s1c1
Sequence:CCGGGCAAGATGAGTTCAGCCGATTCTCGAGAATCGGCTGAACTCATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1159s1c1
Sequence:CCGGCGTCCTTAATGGCTCAGACATCTCGAGATGTCTGAGCCATTAAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-974s1c1
Sequence:CCGGGAGTCCTATTACCCAGAGTATCTCGAGATACTCTGGGTAATAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010577
VALIDATED
ITGA5 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3690s21c1
Sequence:CCGGATCAACTTGGAACCATAATTACTCGAGTAATTATGGTTCCAAGTTGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010577.2-1452s21c1
Sequence:CCGGTGGACCAAGACGGCTACAATGCTCGAGCATTGTAGCCGTCTTGGTCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3079s21c1
Sequence:CCGGGACCTTCTTGCAGCGGGAATACTCGAGTATTCCCGCTGCAAGAAGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1651s21c1
Sequence:CCGGCAATGGATACCCTGATCTAATCTCGAGATTAGATCAGGGTATCCATTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000262763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1506s21c1
Sequence:CCGGCCCAGCAGGGAGTCGTATTTACTCGAGTAAATACGACTCCCTGCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2053s1c1
Sequence:CCGGCCCAATTCACATTGCCCTCAACTCGAGTTGAGGGCAATGTGAATTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2548s1c1
Sequence:CCGGCCTCAGCAAGAACCTGAACAACTCGAGTTGTTCAGGTTCTTGCTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1402s1c1
Sequence:CCGGGCAAGATGAGTTCAGCCGATTCTCGAGAATCGGCTGAACTCATCTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1159s1c1
Sequence:CCGGCGTCCTTAATGGCTCAGACATCTCGAGATGTCTGAGCCATTAAGGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000066102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-974s1c1
Sequence:CCGGGAGTCCTATTACCCAGAGTATCTCGAGATACTCTGGGTAATAGGACTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010577
VALIDATED
ITGA5 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3690s21c1
Sequence:CCGGATCAACTTGGAACCATAATTACTCGAGTAATTATGGTTCCAAGTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010577.2-1452s21c1
Sequence:CCGGTGGACCAAGACGGCTACAATGCTCGAGCATTGTAGCCGTCTTGGTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-3079s21c1
Sequence:CCGGGACCTTCTTGCAGCGGGAATACTCGAGTATTCCCGCTGCAAGAAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1651s21c1
Sequence:CCGGCAATGGATACCCTGATCTAATCTCGAGATTAGATCAGGGTATCCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010577.2-1506s21c1
Sequence:CCGGCCCAGCAGGGAGTCGTATTTACTCGAGTAAATACGACTCCCTGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2053s1c1
Sequence:CCGGCCCAATTCACATTGCCCTCAACTCGAGTTGAGGGCAATGTGAATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-2548s1c1
Sequence:CCGGCCTCAGCAAGAACCTGAACAACTCGAGTTGTTCAGGTTCTTGCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1402s1c1
Sequence:CCGGGCAAGATGAGTTCAGCCGATTCTCGAGAATCGGCTGAACTCATCTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-1159s1c1
Sequence:CCGGCGTCCTTAATGGCTCAGACATCTCGAGATGTCTGAGCCATTAAGGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010577.2-974s1c1
Sequence:CCGGGAGTCCTATTACCCAGAGTATCTCGAGATACTCTGGGTAATAGGACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002205
VALIDATED
ITGA5 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-732s21c1
Sequence:CCGGGGTGGACCAGGAAGCTATTTCCTCGAGGAAATAGCTTCCTGGTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1224s21c1
Sequence:CCGGCATGATGAGTTTGGCCGATTTCTCGAGAAATCGGCCAAACTCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002205.2-3900s21c1
Sequence:CCGGAGGCAGATCCAGGACTATATTCTCGAGAATATAGTCCTGGATCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1474s21c1
Sequence:GTACCGGATGGATATCCTGATCTGATTGCTCGAGCAATCAGATCAGGATATCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1935s21c1
Sequence:CCGGCTCAGGCCAGCCCTACATTATCTCGAGATAATGTAGGGCTGGCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1178s1c1
Sequence:CCGGCCATGATGAGTTTGGCCGATTCTCGAGAATCGGCCAAACTCATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-559s1c1
Sequence:CCGGCCACAGATAACTTCACCCGAACTCGAGTTCGGGTGAAGTTATCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002205.1-2595s1c1
Sequence:CCGGCTCCTATATGTGACCAGAGTTCTCGAGAACTCTGGTCACATATAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1793s1c1
Sequence:CCGGCCTCAGGAACGAGTCAGAATTCTCGAGAATTCTGACTCGTTCCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-3015s1c1
Sequence:CCGGCCACTGTGGATCATCATCCTACTCGAGTAGGATGATGATCCACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002205
VALIDATED
ITGA5 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-732s21c1
Sequence:CCGGGGTGGACCAGGAAGCTATTTCCTCGAGGAAATAGCTTCCTGGTCCACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1224s21c1
Sequence:CCGGCATGATGAGTTTGGCCGATTTCTCGAGAAATCGGCCAAACTCATCATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002205.2-3900s21c1
Sequence:CCGGAGGCAGATCCAGGACTATATTCTCGAGAATATAGTCCTGGATCTGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1474s21c1
Sequence:GTACCGGATGGATATCCTGATCTGATTGCTCGAGCAATCAGATCAGGATATCCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1935s21c1
Sequence:CCGGCTCAGGCCAGCCCTACATTATCTCGAGATAATGTAGGGCTGGCCTGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1178s1c1
Sequence:CCGGCCATGATGAGTTTGGCCGATTCTCGAGAATCGGCCAAACTCATCATGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-559s1c1
Sequence:CCGGCCACAGATAACTTCACCCGAACTCGAGTTCGGGTGAAGTTATCTGTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002205.1-2595s1c1
Sequence:CCGGCTCCTATATGTGACCAGAGTTCTCGAGAACTCTGGTCACATATAGGAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1793s1c1
Sequence:CCGGCCTCAGGAACGAGTCAGAATTCTCGAGAATTCTGACTCGTTCCTGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000029651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-3015s1c1
Sequence:CCGGCCACTGTGGATCATCATCCTACTCGAGTAGGATGATGATCCACAGTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002205
VALIDATED
ITGA5 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-732s21c1
Sequence:CCGGGGTGGACCAGGAAGCTATTTCCTCGAGGAAATAGCTTCCTGGTCCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1224s21c1
Sequence:CCGGCATGATGAGTTTGGCCGATTTCTCGAGAAATCGGCCAAACTCATCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002205.2-3900s21c1
Sequence:CCGGAGGCAGATCCAGGACTATATTCTCGAGAATATAGTCCTGGATCTGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1474s21c1
Sequence:GTACCGGATGGATATCCTGATCTGATTGCTCGAGCAATCAGATCAGGATATCCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002205.2-1935s21c1
Sequence:CCGGCTCAGGCCAGCCCTACATTATCTCGAGATAATGTAGGGCTGGCCTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1178s1c1
Sequence:CCGGCCATGATGAGTTTGGCCGATTCTCGAGAATCGGCCAAACTCATCATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-559s1c1
Sequence:CCGGCCACAGATAACTTCACCCGAACTCGAGTTCGGGTGAAGTTATCTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002205.1-2595s1c1
Sequence:CCGGCTCCTATATGTGACCAGAGTTCTCGAGAACTCTGGTCACATATAGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-1793s1c1
Sequence:CCGGCCTCAGGAACGAGTCAGAATTCTCGAGAATTCTGACTCGTTCCTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002205.1-3015s1c1
Sequence:CCGGCCACTGTGGATCATCATCCTACTCGAGTAGGATGATGATCCACAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)