EMAIL THIS PAGE TO A FRIEND

ITGA6

integrin, alpha 6

189 Gene Product Result for
Synonyms: CD49f ITGA6B VLA-6
Gene ID:
Human(3655) Summary: The ITGA6 protein product is the integrin alpha chain alpha 6. Integrins are integral cell-surface proteins composed of an alpha chain and a beta chain. A given chain may combine with multiple partners resulting in different integrins. For example, alpha 6 may combine with beta 4 in the integrin referred to as TSP180, or with beta 1 in the integrin VLA-6. Integrins are known to participate in cell adhesion as well as cell-surface mediated signalling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16403) integrin alpha 6
Rat(114517) integrin, alpha 6
chicken(396226) integrin, alpha 6
Horse(100064056) integrin, alpha 6
cow(535043) integrin, alpha 6
domestic cat(101092454) integrin, alpha 6
dog(478800) integrin, alpha 6
sheep(101113656) integrin, alpha 6
Domestic Rabbit(100008642) integrin, alpha 6
domestic guinea pig(100731242) integrin, alpha 6
naked mole-rat(101705215) integrin, alpha 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
CBL458 Anti-CD49f Antibody, clone 4F10 This Anti-CD49f Antibody, clone 4F10 is validated for use in FC, IP, IH for the detection of CD49f. pricing
CBL458P Anti-CD49f Antibody, clone 4F10, Phycoerythrin conjugated Detect CD49f using this Anti-CD49f Antibody, clone 4F10, Phycoerythrin conjugated validated for use in FC. pricing
CBL458F Anti-CD49f Antibody, FITC conjugated, clone 4F10, FITC conjugated Anti-CD49f Antibody, FITC conjugated, clone 4F10, FITC conjugated is an antibody against CD49fd for use in FC, IP, IH. pricing
MAB1410 Anti-Integrin α6β1 Antibody, clone-5A This Anti-Integrin α6β1 Antibody, clone-5A is validated for use in ELISA, IH for the detection of Integrin α6β1. pricing
MAB13444 Anti-Integrin α6 Antibody, clone BnC6B4 Anti-Integrin α6 Antibody, clone BnC6B4 is an antibody against Integrin α6 for use in IP, WB, IC, IH. pricing
MAB1982 Anti-Integrin α6 Antibody, clone MA6 This Anti-Integrin α6 Antibody, clone MA6 is validated for use in FC, IP, IH for the detection of Integrin α6. pricing
MAB1378 Anti-Integrin α6 Antibody, clone NKI-GoH3 Detect Integrin α6 using this Anti-Integrin α6 Antibody, clone NKI-GoH3 validated for use in FC, IH. pricing
MAB1358 Anti-Integrin α6B Antibody, cytoplasmic domain, clone 6B4 Anti-Integrin α6B Antibody, cytoplasmic domain, clone 6B4 is an antibody against Integrin α6B for use in WB, IC, IH. pricing
MABT356 Anti-Integrin alpha6 Antibody, clone 6H7.1 This Anti-Integrin alpha6 Antibody, clone 6H7.1 is validated for use in Western Blotting and Immunohistochemistry (Paraffin) for the detection of Integrin alpha6. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000210 Rosetta Predictions human pricing
NM_001079818 Rosetta Predictions human pricing
XM_001059353 Rosetta Predictions rat pricing
XM_001059408 Rosetta Predictions rat pricing
XM_001059465 Rosetta Predictions rat pricing
XM_001059528 Rosetta Predictions rat pricing
XM_215984 Rosetta Predictions rat pricing
NM_008397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036206 predicted 838
2 SASI_Hs01_00036207 predicted 1678
3 SASI_Hs02_00302097 predicted 647
4 SASI_Hs01_00036208 predicted 2328
5 SASI_Hs01_00036209 predicted 1637
6 SASI_Hs02_00302098 predicted 2976
7 SASI_Hs01_00036210 predicted 2705
8 SASI_Hs01_00036211 predicted 2606
9 SASI_Hs01_00036212 predicted 961
10 SASI_Hs01_00036213 predicted 1809
11 SASI_Hs01_00036214 predicted 536
12 SASI_Hs01_00036215 predicted 2478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313810 predicted 838
2 SASI_Hs02_00313811 predicted 1679
3 SASI_Hs02_00313812 predicted 638
4 SASI_Hs02_00313813 predicted 2327
5 SASI_Hs02_00313814 predicted 1634
6 SASI_Hs02_00313815 predicted 2706
7 SASI_Hs02_00313816 predicted 2603
8 SASI_Hs02_00313817 predicted 957
9 SASI_Hs02_00313818 predicted 1813
10 SASI_Hs02_00313819 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059353 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292943 predicted 2103
2 SASI_Rn02_00292944 predicted 773
3 SASI_Rn02_00292945 predicted 1812
4 SASI_Rn02_00292946 predicted 1629
5 SASI_Rn02_00292947 predicted 2485
6 SASI_Rn02_00292948 predicted 918
7 SASI_Rn02_00292949 predicted 885
8 SASI_Rn02_00292950 predicted 2520
9 SASI_Rn02_00292951 predicted 2319
10 SASI_Rn02_00292952 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059408 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293096 predicted 2104
2 SASI_Rn02_00293097 predicted 771
3 SASI_Rn02_00293098 predicted 1811
4 SASI_Rn02_00293099 predicted 1630
5 SASI_Rn02_00293100 predicted 2491
6 SASI_Rn02_00293101 predicted 921
7 SASI_Rn02_00293102 predicted 886
8 SASI_Rn02_00293103 predicted 2522
9 SASI_Rn02_00293104 predicted 2320
10 SASI_Rn02_00293105 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059465 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293315 predicted 2087
2 SASI_Rn02_00293316 predicted 778
3 SASI_Rn02_00293317 predicted 3446
4 SASI_Rn02_00293318 predicted 1794
5 SASI_Rn02_00293319 predicted 1622
6 SASI_Rn02_00293320 predicted 2475
7 SASI_Rn02_00293321 predicted 2510
8 SASI_Rn02_00293322 predicted 2299
9 SASI_Rn02_00293323 predicted 2273
10 SASI_Rn02_00293324 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059528 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293519 predicted 2104
2 SASI_Rn02_00293520 predicted 3466
3 SASI_Rn02_00293521 predicted 1804
4 SASI_Rn02_00293522 predicted 1630
5 SASI_Rn02_00293523 predicted 2483
6 SASI_Rn02_00293524 predicted 924
7 SASI_Rn02_00293525 predicted 884
8 SASI_Rn02_00293526 predicted 2526
9 SASI_Rn02_00293527 predicted 2320
10 SASI_Rn02_00293528 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376336 predicted 2103
2 SASI_Rn02_00376337 predicted 777
3 SASI_Rn02_00376338 predicted 1808
4 SASI_Rn02_00376339 predicted 1631
5 SASI_Rn02_00376340 predicted 2484
6 SASI_Rn02_00376341 predicted 922
7 SASI_Rn02_00376342 predicted 891
8 SASI_Rn02_00376343 predicted 2519
9 SASI_Rn02_00376344 predicted 2321
10 SASI_Rn02_00376345 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141160 predicted 1959
2 SASI_Mm01_00141161 predicted 1899
3 SASI_Mm01_00141162 predicted 2339
4 SASI_Mm01_00141163 predicted 2281
5 SASI_Mm01_00141164 predicted 2540
6 SASI_Mm01_00141165 predicted 629
7 SASI_Mm01_00141166 predicted 2821
8 SASI_Mm01_00141167 predicted 2377
9 SASI_Mm01_00141168 predicted 1130
10 SASI_Mm01_00141169 predicted 1342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000210
VALIDATED
ITGA6 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-3821s21c1
Sequence:CCGGTTCTTTAACTGCCGTAATTTACTCGAGTAAATTACGGCAGTTAAAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-3345s21c1
Sequence:CCGGGATCATTATGATGCCACATATCTCGAGATATGTGGCATCATAATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-2136s21c1
Sequence:CCGGCGAGAAGGAAATCAAGACAAACTCGAGTTTGTCTTGATTTCCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-294s21c1
Sequence:CCGGGACAACGTGATCCGGAAATATCTCGAGATATTTCCGGATCACGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-489s21c1
Sequence:CCGGCGGATCGAGTTTGATAACGATCTCGAGATCGTTATCAAACTCGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-1508s1c1
Sequence:CCGGCCTCTCAGATTCAGTAACTATCTCGAGATAGTTACTGAATCTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-432s1c1
Sequence:CCGGCGGATCGAGTTTGATAACGATCTCGAGATCGTTATCAAACTCGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-2079s1c1
Sequence:CCGGCGAGAAGGAAATCAAGACAAACTCGAGTTTGTCTTGATTTCCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-2648s1c1
Sequence:CCGGCAGGGTAATAAACTTAGGTAACTCGAGTTACCTAAGTTTATTACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000210.1-3288s1c1
Sequence:CCGGGATCATTATGATGCCACATATCTCGAGATATGTGGCATCATAATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000210
VALIDATED
ITGA6 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-3821s21c1
Sequence:CCGGTTCTTTAACTGCCGTAATTTACTCGAGTAAATTACGGCAGTTAAAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-3345s21c1
Sequence:CCGGGATCATTATGATGCCACATATCTCGAGATATGTGGCATCATAATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-2136s21c1
Sequence:CCGGCGAGAAGGAAATCAAGACAAACTCGAGTTTGTCTTGATTTCCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-294s21c1
Sequence:CCGGGACAACGTGATCCGGAAATATCTCGAGATATTTCCGGATCACGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-489s21c1
Sequence:CCGGCGGATCGAGTTTGATAACGATCTCGAGATCGTTATCAAACTCGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-1508s1c1
Sequence:CCGGCCTCTCAGATTCAGTAACTATCTCGAGATAGTTACTGAATCTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-432s1c1
Sequence:CCGGCGGATCGAGTTTGATAACGATCTCGAGATCGTTATCAAACTCGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-2079s1c1
Sequence:CCGGCGAGAAGGAAATCAAGACAAACTCGAGTTTGTCTTGATTTCCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-2648s1c1
Sequence:CCGGCAGGGTAATAAACTTAGGTAACTCGAGTTACCTAAGTTTATTACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000210.1-3288s1c1
Sequence:CCGGGATCATTATGATGCCACATATCTCGAGATATGTGGCATCATAATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000210
VALIDATED
ITGA6 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-3821s21c1
Sequence:CCGGTTCTTTAACTGCCGTAATTTACTCGAGTAAATTACGGCAGTTAAAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-3345s21c1
Sequence:CCGGGATCATTATGATGCCACATATCTCGAGATATGTGGCATCATAATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-2136s21c1
Sequence:CCGGCGAGAAGGAAATCAAGACAAACTCGAGTTTGTCTTGATTTCCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-294s21c1
Sequence:CCGGGACAACGTGATCCGGAAATATCTCGAGATATTTCCGGATCACGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000210.2-489s21c1
Sequence:CCGGCGGATCGAGTTTGATAACGATCTCGAGATCGTTATCAAACTCGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-1508s1c1
Sequence:CCGGCCTCTCAGATTCAGTAACTATCTCGAGATAGTTACTGAATCTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-432s1c1
Sequence:CCGGCGGATCGAGTTTGATAACGATCTCGAGATCGTTATCAAACTCGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-2079s1c1
Sequence:CCGGCGAGAAGGAAATCAAGACAAACTCGAGTTTGTCTTGATTTCCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_000210.1-2648s1c1
Sequence:CCGGCAGGGTAATAAACTTAGGTAACTCGAGTTACCTAAGTTTATTACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000210.1-3288s1c1
Sequence:CCGGGATCATTATGATGCCACATATCTCGAGATATGTGGCATCATAATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008397
VALIDATED
ITGA6 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-3245s1c1
Sequence:CCGGCGTCTGATAAAGAGAGGCTTACTCGAGTAAGCCTCTCTTTATCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-2595s1c1
Sequence:CCGGCGGCACAGCAACCTTGAATATCTCGAGATATTCAAGGTTGCTGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-2274s1c1
Sequence:CCGGCGGAAATCCTTTCAAGAGAAACTCGAGTTTCTCTTGAAAGGATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008397.2-679s1c1
Sequence:CCGGCCAGGGACTTACAACTGGAAACTCGAGTTTCCAGTTGTAAGTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-1545s1c1
Sequence:CCGGCCTCAAGGTTAAAGCCTGTTTCTCGAGAAACAGGCTTTAACCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008397
VALIDATED
ITGA6 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-3245s1c1
Sequence:CCGGCGTCTGATAAAGAGAGGCTTACTCGAGTAAGCCTCTCTTTATCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-2595s1c1
Sequence:CCGGCGGCACAGCAACCTTGAATATCTCGAGATATTCAAGGTTGCTGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-2274s1c1
Sequence:CCGGCGGAAATCCTTTCAAGAGAAACTCGAGTTTCTCTTGAAAGGATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008397.2-679s1c1
Sequence:CCGGCCAGGGACTTACAACTGGAAACTCGAGTTTCCAGTTGTAAGTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-1545s1c1
Sequence:CCGGCCTCAAGGTTAAAGCCTGTTTCTCGAGAAACAGGCTTTAACCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008397
VALIDATED
ITGA6 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-3245s1c1
Sequence:CCGGCGTCTGATAAAGAGAGGCTTACTCGAGTAAGCCTCTCTTTATCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-2595s1c1
Sequence:CCGGCGGCACAGCAACCTTGAATATCTCGAGATATTCAAGGTTGCTGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-2274s1c1
Sequence:CCGGCGGAAATCCTTTCAAGAGAAACTCGAGTTTCTCTTGAAAGGATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008397.2-679s1c1
Sequence:CCGGCCAGGGACTTACAACTGGAAACTCGAGTTTCCAGTTGTAAGTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008397.2-1545s1c1
Sequence:CCGGCCTCAAGGTTAAAGCCTGTTTCTCGAGAAACAGGCTTTAACCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)