EMAIL THIS PAGE TO A FRIEND

ITGA7

integrin, alpha 7

94 Gene Product Result for
Gene ID:
Human(3679) Summary: The protein encoded by this gene belongs to the integrin alpha chain family. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. They mediate a wide spectrum of cell-cell and cell-matrix interactions, and thus play a role in cell migration, morphologic development, differentiation, and metastasis. This protein functions as a receptor for the basement membrane protein laminin-1. It is mainly expressed in skeletal and cardiac muscles and may be involved in differentiation and migration processes during myogenesis. Defects in this gene are associated with congenital myopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2009]
Mouse(16404) integrin alpha 7
Rat(81008) integrin, alpha 7
Zebrafish(100006255) integrin, alpha 7
chicken(101667236) integrin, alpha 7
chicken(101749098) integrin, alpha 7
cow(506953) integrin, alpha 7
Horse(100058756) integrin, alpha 7
domestic cat(101089783) integrin, alpha 7
dog(481097) integrin, alpha 7
domestic guinea pig(100716758) integrin, alpha 7
naked mole-rat(101702836) integrin, alpha 7
sheep(101115445) integrin, alpha 7
Domestic Rabbit(100346005) integrin, alpha 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002206 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002206 Rosetta Predictions human pricing
NM_030842 Rosetta Predictions rat pricing
NM_008398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227199 predicted 1182
2 SASI_Hs01_00227200 predicted 1459
3 SASI_Hs01_00227201 predicted 2056
4 SASI_Hs01_00227202 predicted 2452
5 SASI_Hs01_00227203 predicted 1497
6 SASI_Hs01_00227204 predicted 2039
7 SASI_Hs01_00227205 predicted 941
8 SASI_Hs01_00227207 predicted 1903
9 SASI_Hs01_00227208 predicted 1494
10 SASI_Hs02_00333428 predicted 1926
11 SASI_Hs01_00227206 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042552 predicted 801
2 SASI_Rn01_00042553 predicted 1061
3 SASI_Rn01_00042554 predicted 1341
4 SASI_Rn01_00042555 predicted 820
5 SASI_Rn01_00042557 predicted 1551
6 SASI_Rn01_00042558 predicted 1608
7 SASI_Rn01_00042559 predicted 2479
8 SASI_Rn01_00042560 predicted 2734
9 SASI_Rn01_00042561 predicted 839
10 SASI_Rn02_00264070 predicted 933
11 SASI_Rn01_00042556 predicted 1959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087772 predicted 938
2 SASI_Mm02_00313829 predicted 2087
3 SASI_Mm01_00087774 predicted 3172
4 SASI_Mm01_00087775 predicted 1473
5 SASI_Mm01_00087776 predicted 476
6 SASI_Mm01_00087777 predicted 968
7 SASI_Mm01_00087778 predicted 3222
8 SASI_Mm02_00313830 predicted 3125
9 SASI_Mm01_00087780 predicted 2200
10 SASI_Mm01_00087781 predicted 1690
11 SASI_Mm01_00087773 predicted 2092
12 SASI_Mm01_00087779 predicted 3137
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008398
ITGA7 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-1311s21c1
Sequence:CCGGTCCATGTTTGGGATCAGTTTGCTCGAGCAAACTGATCCCAAACATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-3130s21c1
Sequence:CCGGAGGAGTACATGGCCGTGAAATCTCGAGATTTCACGGCCATGTACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-977s21c1
Sequence:CCGGCGATTCTGGGAAGGGTCTTATCTCGAGATAAGACCCTTCCCAGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-935s1c1
Sequence:CCGGCCGGAGACTTGACCTTGAATACTCGAGTATTCAAGGTCAAGTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-211s1c1
Sequence:CCGGCCCGGAATCTACTATCTTATTCTCGAGAATAAGATAGTAGATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-1198s1c1
Sequence:CCGGCCCTACTTCTTTGAACGCCAACTCGAGTTGGCGTTCAAAGAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008398.1-3605s1c1
Sequence:CCGGCCGTGGTTCCTTTCGCCCTTTCTCGAGAAAGGGCGAAAGGAACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-3163s1c1
Sequence:CCGGCGAGCCAACATCACAGTGAAACTCGAGTTTCACTGTGATGTTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008398
ITGA7 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-1311s21c1
Sequence:CCGGTCCATGTTTGGGATCAGTTTGCTCGAGCAAACTGATCCCAAACATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-3130s21c1
Sequence:CCGGAGGAGTACATGGCCGTGAAATCTCGAGATTTCACGGCCATGTACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-977s21c1
Sequence:CCGGCGATTCTGGGAAGGGTCTTATCTCGAGATAAGACCCTTCCCAGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-935s1c1
Sequence:CCGGCCGGAGACTTGACCTTGAATACTCGAGTATTCAAGGTCAAGTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-211s1c1
Sequence:CCGGCCCGGAATCTACTATCTTATTCTCGAGAATAAGATAGTAGATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-1198s1c1
Sequence:CCGGCCCTACTTCTTTGAACGCCAACTCGAGTTGGCGTTCAAAGAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008398.1-3605s1c1
Sequence:CCGGCCGTGGTTCCTTTCGCCCTTTCTCGAGAAAGGGCGAAAGGAACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-3163s1c1
Sequence:CCGGCGAGCCAACATCACAGTGAAACTCGAGTTTCACTGTGATGTTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008398
ITGA7 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-1311s21c1
Sequence:CCGGTCCATGTTTGGGATCAGTTTGCTCGAGCAAACTGATCCCAAACATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-3130s21c1
Sequence:CCGGAGGAGTACATGGCCGTGAAATCTCGAGATTTCACGGCCATGTACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008398.2-977s21c1
Sequence:CCGGCGATTCTGGGAAGGGTCTTATCTCGAGATAAGACCCTTCCCAGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-935s1c1
Sequence:CCGGCCGGAGACTTGACCTTGAATACTCGAGTATTCAAGGTCAAGTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-211s1c1
Sequence:CCGGCCCGGAATCTACTATCTTATTCTCGAGAATAAGATAGTAGATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-1198s1c1
Sequence:CCGGCCCTACTTCTTTGAACGCCAACTCGAGTTGGCGTTCAAAGAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008398.1-3605s1c1
Sequence:CCGGCCGTGGTTCCTTTCGCCCTTTCTCGAGAAAGGGCGAAAGGAACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008398.1-3163s1c1
Sequence:CCGGCGAGCCAACATCACAGTGAAACTCGAGTTTCACTGTGATGTTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002206
ITGA7 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 7
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-809s1c1
Sequence:CCGGCCCAGGAACCTATAATTGGAACTCGAGTTCCAATTATAGGTTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-196s1c1
Sequence:CCGGCCTCCGGGATTTGCTACCTTTCTCGAGAAAGGTAGCAAATCCCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-1728s1c1
Sequence:CCGGGCCCTGGACTATGTGTTAGATCTCGAGATCTAACACATAGTCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-3176s1c1
Sequence:CCGGGTCCTCCATAAAGAACTTGATCTCGAGATCAAGTTCTTTATGGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002206
ITGA7 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 7
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-809s1c1
Sequence:CCGGCCCAGGAACCTATAATTGGAACTCGAGTTCCAATTATAGGTTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-196s1c1
Sequence:CCGGCCTCCGGGATTTGCTACCTTTCTCGAGAAAGGTAGCAAATCCCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-1728s1c1
Sequence:CCGGGCCCTGGACTATGTGTTAGATCTCGAGATCTAACACATAGTCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-3176s1c1
Sequence:CCGGGTCCTCCATAAAGAACTTGATCTCGAGATCAAGTTCTTTATGGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002206
ITGA7 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 7
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-809s1c1
Sequence:CCGGCCCAGGAACCTATAATTGGAACTCGAGTTCCAATTATAGGTTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-196s1c1
Sequence:CCGGCCTCCGGGATTTGCTACCTTTCTCGAGAAAGGTAGCAAATCCCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-1728s1c1
Sequence:CCGGGCCCTGGACTATGTGTTAGATCTCGAGATCTAACACATAGTCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002206.1-3176s1c1
Sequence:CCGGGTCCTCCATAAAGAACTTGATCTCGAGATCAAGTTCTTTATGGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)