EMAIL THIS PAGE TO A FRIEND

ITGA8

integrin, alpha 8

61 Gene Product Result for
UniProtKB ID: P53708, B0YJ31, Q5VX94
Gene ID:
Mouse(241226) integrin alpha 8
Rat(364786) integrin, alpha 8
sheep(101117689) integrin, alpha 8
Domestic Rabbit(100351181) integrin, alpha 8
domestic guinea pig(100721946) integrin, alpha 8
naked mole-rat(101724376) integrin, alpha 8
Zebrafish(100141346) integrin, alpha 8
cow(511976) integrin, alpha 8
domestic cat(101100222) integrin, alpha 8
dog(487119) integrin, alpha 8
chicken(396225) integrin, alpha 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_140813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003638 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043621 MISSION® esiRNA esiRNA human ITGA8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003638 Rosetta Predictions human pricing
XM_001072297 Rosetta Predictions rat pricing
XM_344634 Rosetta Predictions rat pricing
NM_001001309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207161 predicted 1786
2 SASI_Hs01_00207162 predicted 2448
3 SASI_Hs01_00207163 predicted 785
4 SASI_Hs01_00207165 predicted 2270
5 SASI_Hs02_00335992 predicted 1272
6 SASI_Hs01_00207166 predicted 2601
7 SASI_Hs02_00335993 predicted 1536
8 SASI_Hs02_00335994 predicted 590
9 SASI_Hs02_00335995 predicted 1193
10 SASI_Hs01_00207169 predicted 1880
11 SASI_Hs01_00207164 predicted 948
12 SASI_Hs01_00207167 predicted 1849
13 SASI_Hs01_00207168 predicted 2941
14 SASI_Hs01_00207170 predicted 2680
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338582 predicted 2747
2 SASI_Rn02_00338583 predicted 3062
3 SASI_Rn02_00338584 predicted 2450
4 SASI_Rn02_00338585 predicted 3218
5 SASI_Rn02_00338586 predicted 3157
6 SASI_Rn02_00338587 predicted 2361
7 SASI_Rn02_00338588 predicted 2982
8 SASI_Rn02_00338589 predicted 3397
9 SASI_Rn02_00338590 predicted 2406
10 SASI_Rn02_00338591 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397354 predicted 1871
2 SASI_Rn02_00397355 predicted 1596
3 SASI_Rn02_00397356 predicted 3277
4 SASI_Rn02_00397357 predicted 3431
5 SASI_Rn02_00397358 predicted 3375
6 SASI_Rn02_00397359 predicted 2575
7 SASI_Rn02_00397360 predicted 3202
8 SASI_Rn02_00397361 predicted 3614
9 SASI_Rn02_00397362 predicted 881
10 SASI_Rn02_00397363 predicted 2397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286114 predicted 834
2 SASI_Mm01_00032724 predicted 3206
3 SASI_Mm01_00032725 predicted 3165
4 SASI_Mm01_00032726 predicted 723
5 SASI_Mm01_00032727 predicted 3058
6 SASI_Mm01_00032728 predicted 2747
7 SASI_Mm01_00032730 predicted 3138
8 SASI_Mm02_00286115 predicted 2676
9 SASI_Mm01_00032731 predicted 2907
10 SASI_Mm01_00032732 predicted 2420
11 SASI_Mm01_00032723 predicted 850
12 SASI_Mm01_00032729 predicted 2109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140813
ITGA8 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1162s1c1
Sequence:CCGGCCTCTCTTTATGGAGCGAGAACTCGAGTTCTCGCTCCATAAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1624s1c1
Sequence:CCGGCCGATGATTATCAACCTTGAACTCGAGTTCAAGGTTGATAATCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-2680s1c1
Sequence:CCGGCGGGATGAGTTTCTCCTCTATCTCGAGATAGAGGAGAAACTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1914s1c1
Sequence:CCGGCCGAGATAAATTGTCTCCAATCTCGAGATTGGAGACAATTTATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-3074s1c1
Sequence:CCGGCGTATAAAGAACAGCCAGCAACTCGAGTTGCTGGCTGTTCTTTATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140813
ITGA8 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1162s1c1
Sequence:CCGGCCTCTCTTTATGGAGCGAGAACTCGAGTTCTCGCTCCATAAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1624s1c1
Sequence:CCGGCCGATGATTATCAACCTTGAACTCGAGTTCAAGGTTGATAATCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-2680s1c1
Sequence:CCGGCGGGATGAGTTTCTCCTCTATCTCGAGATAGAGGAGAAACTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1914s1c1
Sequence:CCGGCCGAGATAAATTGTCTCCAATCTCGAGATTGGAGACAATTTATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-3074s1c1
Sequence:CCGGCGTATAAAGAACAGCCAGCAACTCGAGTTGCTGGCTGTTCTTTATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140813
ITGA8 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1162s1c1
Sequence:CCGGCCTCTCTTTATGGAGCGAGAACTCGAGTTCTCGCTCCATAAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1624s1c1
Sequence:CCGGCCGATGATTATCAACCTTGAACTCGAGTTCAAGGTTGATAATCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-2680s1c1
Sequence:CCGGCGGGATGAGTTTCTCCTCTATCTCGAGATAGAGGAGAAACTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-1914s1c1
Sequence:CCGGCCGAGATAAATTGTCTCCAATCTCGAGATTGGAGACAATTTATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_140813.3-3074s1c1
Sequence:CCGGCGTATAAAGAACAGCCAGCAACTCGAGTTGCTGGCTGTTCTTTATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003638
ITGA8 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-1027s1c1
Sequence:CCGGCCTCTCTTTATGGAACGTGAACTCGAGTTCACGTTCCATAAAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-1779s1c1
Sequence:CCGGCCGAGATAAATTATCTCCAATCTCGAGATTGGAGATAATTTATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-2838s1c1
Sequence:CCGGCCTGAAAGTCAGGTCACGATTCTCGAGAATCGTGACCTGACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-2086s1c1
Sequence:CCGGGCAGATTATGTTGGAATCGAACTCGAGTTCGATTCCAACATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-379s1c1
Sequence:CCGGCCTATCGAGTTCAAATCCAATCTCGAGATTGGATTTGAACTCGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003638
ITGA8 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-1027s1c1
Sequence:CCGGCCTCTCTTTATGGAACGTGAACTCGAGTTCACGTTCCATAAAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-1779s1c1
Sequence:CCGGCCGAGATAAATTATCTCCAATCTCGAGATTGGAGATAATTTATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-2838s1c1
Sequence:CCGGCCTGAAAGTCAGGTCACGATTCTCGAGAATCGTGACCTGACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-2086s1c1
Sequence:CCGGGCAGATTATGTTGGAATCGAACTCGAGTTCGATTCCAACATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-379s1c1
Sequence:CCGGCCTATCGAGTTCAAATCCAATCTCGAGATTGGATTTGAACTCGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003638
ITGA8 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-1027s1c1
Sequence:CCGGCCTCTCTTTATGGAACGTGAACTCGAGTTCACGTTCCATAAAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-1779s1c1
Sequence:CCGGCCGAGATAAATTATCTCCAATCTCGAGATTGGAGATAATTTATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-2838s1c1
Sequence:CCGGCCTGAAAGTCAGGTCACGATTCTCGAGAATCGTGACCTGACTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-2086s1c1
Sequence:CCGGGCAGATTATGTTGGAATCGAACTCGAGTTCGATTCCAACATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003638.1-379s1c1
Sequence:CCGGCCTATCGAGTTCAAATCCAATCTCGAGATTGGATTTGAACTCGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)