EMAIL THIS PAGE TO A FRIEND

ITGAE

integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)

75 Gene Product Result for
Synonyms: CD103 HUMINAE
UniProtKB ID: P38570, Q17RS6, Q9NZU9
Gene ID:
Human(3682) Summary: Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
Mouse(16407) integrin alpha E, epithelial-associated
Rat(83577) integrin, alpha E
cow(100140050) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Horse(100072673) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
dog(480659) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
domestic cat(493694) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
domestic guinea pig(100731011) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
naked mole-rat(101725202) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
sheep(101110688) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Domestic Rabbit(100355227) integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002208 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002208 Rosetta Predictions human pricing
NM_031768 Rosetta Predictions rat pricing
NM_008399 Rosetta Predictions mouse pricing
NM_172944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033602 predicted 3562
2 SASI_Hs01_00033603 predicted 3268
3 SASI_Hs02_00333430 predicted 2449
4 SASI_Hs01_00033604 predicted 2733
5 SASI_Hs02_00333431 predicted 1188
6 SASI_Hs02_00333432 predicted 3112
7 SASI_Hs01_00033605 predicted 3095
8 SASI_Hs01_00033606 predicted 3053
9 SASI_Hs01_00033607 predicted 3246
10 SASI_Hs01_00033608 predicted 1467
11 SASI_Hs01_00033609 predicted 3525
12 SASI_Hs01_00033610 predicted 2725
13 SASI_Hs01_00033611 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057592 predicted 2468
2 SASI_Rn01_00057593 predicted 3580
3 SASI_Rn01_00057594 predicted 2278
4 SASI_Rn01_00057595 predicted 1754
5 SASI_Rn02_00265195 predicted 2698
6 SASI_Rn01_00057596 predicted 2765
7 SASI_Rn01_00057597 predicted 3346
8 SASI_Rn01_00057599 predicted 348
9 SASI_Rn01_00057600 predicted 355
10 SASI_Rn01_00057601 predicted 3264
11 SASI_Rn01_00057598 predicted 3674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065301 predicted 2368
2 SASI_Mm01_00065303 predicted 2563
3 SASI_Mm01_00065304 predicted 2605
4 SASI_Mm02_00313831 predicted 2632
5 SASI_Mm01_00065305 predicted 2672
6 SASI_Mm02_00313832 predicted 2642
7 SASI_Mm01_00065306 predicted 1874
8 SASI_Mm01_00065307 predicted 2466
9 SASI_Mm01_00065308 predicted 2538
10 SASI_Mm01_00065309 predicted 2592
11 SASI_Mm01_00065302 predicted 1660
12 SASI_Mm01_00065310 predicted 1858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142099 predicted 2343
2 SASI_Mm01_00142101 predicted 2533
3 SASI_Mm01_00142102 predicted 2581
4 SASI_Mm02_00344970 predicted 2608
5 SASI_Mm01_00142103 predicted 2648
6 SASI_Mm02_00344971 predicted 2616
7 SASI_Mm01_00142104 predicted 1852
8 SASI_Mm01_00142105 predicted 2444
9 SASI_Mm01_00142106 predicted 2519
10 SASI_Mm01_00142107 predicted 2566
11 SASI_Mm01_00142100 predicted 1645
12 SASI_Mm01_00142108 predicted 1831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008399
ITGAE MISSION shRNA Bacterial Glycerol Stock
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-1944s21c1
Sequence:CCGGGTGTCCGGTGGGTTAGATTTCCTCGAGGAAATCTAACCCACCGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-1118s1c1
Sequence:CCGGCCACACTTTCAAGGTGACCAACTCGAGTTGGTCACCTTGAAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008399.1-3689s1c1
Sequence:CCGGGCCCACAGTGTCTTGTGAATTCTCGAGAATTCACAAGACACTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-3241s1c1
Sequence:CCGGGCCACACTAAGCAGTTACTAACTCGAGTTAGTAACTGCTTAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-2886s1c1
Sequence:CCGGCGCAGCCTTCAATTCAGACATCTCGAGATGTCTGAATTGAAGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-2180s1c1
Sequence:CCGGCCTTAGAGAGATGTTCCTCAACTCGAGTTGAGGAACATCTCTCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-226s21c1
Sequence:CCGGCCCTGTATCGATGCGCTATATCTCGAGATATAGCGCATCGATACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-3253s21c1
Sequence:CCGGTGCCGATCCTTGGTGAAATATCTCGAGATATTTCACCAAGGATCGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-930s21c1
Sequence:CCGGCTTACTGATGGTGACATATTTCTCGAGAAATATGTCACCATCAGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008399
ITGAE MISSION shRNA shRNA Plasmid DNA
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-1944s21c1
Sequence:CCGGGTGTCCGGTGGGTTAGATTTCCTCGAGGAAATCTAACCCACCGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-1118s1c1
Sequence:CCGGCCACACTTTCAAGGTGACCAACTCGAGTTGGTCACCTTGAAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008399.1-3689s1c1
Sequence:CCGGGCCCACAGTGTCTTGTGAATTCTCGAGAATTCACAAGACACTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-3241s1c1
Sequence:CCGGGCCACACTAAGCAGTTACTAACTCGAGTTAGTAACTGCTTAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-2886s1c1
Sequence:CCGGCGCAGCCTTCAATTCAGACATCTCGAGATGTCTGAATTGAAGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-2180s1c1
Sequence:CCGGCCTTAGAGAGATGTTCCTCAACTCGAGTTGAGGAACATCTCTCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-226s21c1
Sequence:CCGGCCCTGTATCGATGCGCTATATCTCGAGATATAGCGCATCGATACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-3253s21c1
Sequence:CCGGTGCCGATCCTTGGTGAAATATCTCGAGATATTTCACCAAGGATCGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-930s21c1
Sequence:CCGGCTTACTGATGGTGACATATTTCTCGAGAAATATGTCACCATCAGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008399
ITGAE MISSION shRNA Lentiviral Transduction Particles
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-1944s21c1
Sequence:CCGGGTGTCCGGTGGGTTAGATTTCCTCGAGGAAATCTAACCCACCGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-1118s1c1
Sequence:CCGGCCACACTTTCAAGGTGACCAACTCGAGTTGGTCACCTTGAAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066403    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008399.1-3689s1c1
Sequence:CCGGGCCCACAGTGTCTTGTGAATTCTCGAGAATTCACAAGACACTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-3241s1c1
Sequence:CCGGGCCACACTAAGCAGTTACTAACTCGAGTTAGTAACTGCTTAGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-2886s1c1
Sequence:CCGGCGCAGCCTTCAATTCAGACATCTCGAGATGTCTGAATTGAAGGCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008399.1-2180s1c1
Sequence:CCGGCCTTAGAGAGATGTTCCTCAACTCGAGTTGAGGAACATCTCTCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-226s21c1
Sequence:CCGGCCCTGTATCGATGCGCTATATCTCGAGATATAGCGCATCGATACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-3253s21c1
Sequence:CCGGTGCCGATCCTTGGTGAAATATCTCGAGATATTTCACCAAGGATCGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008399.2-930s21c1
Sequence:CCGGCTTACTGATGGTGACATATTTCTCGAGAAATATGTCACCATCAGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002208
VALIDATED
ITGAE MISSION shRNA Bacterial Glycerol Stock
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-540s1c1
Sequence:CCGGGCCAACTTCTTCGACCTTGAACTCGAGTTCAAGGTCGAAGAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-2683s1c1
Sequence:CCGGCCCTGAACATTAACCTAACTACTCGAGTAGTTAGGTTAATGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002208.3-1082s1c1
Sequence:CCGGCCTCAACCTTACGACAGTCATCTCGAGATGACTGTCGTAAGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-2589s1c1
Sequence:CCGGGCCTGCAAGAATAAGCTGTTTCTCGAGAAACAGCTTATTCTTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002208.4-3647s21c1
Sequence:CCGGTATCCACTGGGAGAGGCTATCCTCGAGGATAGCCTCTCCCAGTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-3324s21c1
Sequence:CCGGTCACTCTGAGGAGTTACTAAACTCGAGTTTAGTAACTCCTCAGAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002208.4-3506s21c1
Sequence:CCGGTTCTGGTGTTGATCGTGATTCCTCGAGGAATCACGATCAACACCAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-2195s21c1
Sequence:CCGGGCGTCGTGAATGTCCGTTTATCTCGAGATAAACGGACATTCACGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002208.4-2935s21c1
Sequence:CCGGTCCAATGAAAGACGGTCTTTGCTCGAGCAAAGACCGTCTTTCATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002208.4-3689s21c1
Sequence:CCGGACCCAGCATCCTTTGCATTACCTCGAGGTAATGCAAAGGATGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-3359s21c1
Sequence:CCGGTGCAGATCCTTGGTGAAATATCTCGAGATATTTCACCAAGGATCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002208
VALIDATED
ITGAE MISSION shRNA shRNA Plasmid DNA
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-540s1c1
Sequence:CCGGGCCAACTTCTTCGACCTTGAACTCGAGTTCAAGGTCGAAGAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-2683s1c1
Sequence:CCGGCCCTGAACATTAACCTAACTACTCGAGTAGTTAGGTTAATGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002208.3-1082s1c1
Sequence:CCGGCCTCAACCTTACGACAGTCATCTCGAGATGACTGTCGTAAGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-2589s1c1
Sequence:CCGGGCCTGCAAGAATAAGCTGTTTCTCGAGAAACAGCTTATTCTTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002208.4-3647s21c1
Sequence:CCGGTATCCACTGGGAGAGGCTATCCTCGAGGATAGCCTCTCCCAGTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-3324s21c1
Sequence:CCGGTCACTCTGAGGAGTTACTAAACTCGAGTTTAGTAACTCCTCAGAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002208.4-3506s21c1
Sequence:CCGGTTCTGGTGTTGATCGTGATTCCTCGAGGAATCACGATCAACACCAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-2195s21c1
Sequence:CCGGGCGTCGTGAATGTCCGTTTATCTCGAGATAAACGGACATTCACGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002208.4-2935s21c1
Sequence:CCGGTCCAATGAAAGACGGTCTTTGCTCGAGCAAAGACCGTCTTTCATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002208.4-3689s21c1
Sequence:CCGGACCCAGCATCCTTTGCATTACCTCGAGGTAATGCAAAGGATGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-3359s21c1
Sequence:CCGGTGCAGATCCTTGGTGAAATATCTCGAGATATTTCACCAAGGATCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002208
VALIDATED
ITGAE MISSION shRNA Lentiviral Transduction Particles
integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-540s1c1
Sequence:CCGGGCCAACTTCTTCGACCTTGAACTCGAGTTCAAGGTCGAAGAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-2683s1c1
Sequence:CCGGCCCTGAACATTAACCTAACTACTCGAGTAGTTAGGTTAATGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002208.3-1082s1c1
Sequence:CCGGCCTCAACCTTACGACAGTCATCTCGAGATGACTGTCGTAAGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002208.3-2589s1c1
Sequence:CCGGGCCTGCAAGAATAAGCTGTTTCTCGAGAAACAGCTTATTCTTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369783    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002208.4-3647s21c1
Sequence:CCGGTATCCACTGGGAGAGGCTATCCTCGAGGATAGCCTCTCCCAGTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-3324s21c1
Sequence:CCGGTCACTCTGAGGAGTTACTAAACTCGAGTTTAGTAACTCCTCAGAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002208.4-3506s21c1
Sequence:CCGGTTCTGGTGTTGATCGTGATTCCTCGAGGAATCACGATCAACACCAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-2195s21c1
Sequence:CCGGGCGTCGTGAATGTCCGTTTATCTCGAGATAAACGGACATTCACGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002208.4-2935s21c1
Sequence:CCGGTCCAATGAAAGACGGTCTTTGCTCGAGCAAAGACCGTCTTTCATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002208.4-3689s21c1
Sequence:CCGGACCCAGCATCCTTTGCATTACCTCGAGGTAATGCAAAGGATGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002208.4-3359s21c1
Sequence:CCGGTGCAGATCCTTGGTGAAATATCTCGAGATATTTCACCAAGGATCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)