EMAIL THIS PAGE TO A FRIEND

ITGAL

integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)

77 Gene Product Result for
Synonyms: CD11A LFA-1 LFA1A
UniProtKB ID: P20701, O43746, Q45H73, Q96HB1, Q9UBC8
Gene ID:
Human(3683) Summary: ITGAL encodes the integrin alpha L chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form the integrin lymphocyte function-associated antigen-1 (LFA-1), which is expressed on all leukocytes. LFA-1 plays a central role in leukocyte intercellular adhesion through interactions with its ligands, ICAMs 1-3 (intercellular adhesion molecules 1 through 3), and also functions in lymphocyte costimulatory signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16408) integrin alpha L
Rat(308995) integrin, alpha L
sheep(641296) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Domestic Rabbit(100356927) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
domestic guinea pig(100713143) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
naked mole-rat(101723643) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
domestic cat(101085940) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
cow(281874) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Horse(100065508) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
dog(489905) integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501283 Anti-ITGAL antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human
ELISA, immunohistochemistry, western blot pricing
SAB4700377 Monoclonal Anti-CD11a antibody produced in mouse clone MEM-25, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700383 Monoclonal Anti-CD11a antibody produced in mouse clone MEM-83, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700578 Monoclonal Anti-CD11a antibody produced in rat clone M17/4, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700579 Monoclonal Anti-CD11a low endotoxin antibody produced in rat clone M17/4, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700376 Monoclonal Anti-CD11a, azide free antibody produced in mouse clone MEM-25, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700382 Monoclonal Anti-CD11a, azide free antibody produced in mouse clone MEM-83, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700378 Monoclonal Anti-CD11a-APC antibody produced in mouse clone MEM-25, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700379 Monoclonal Anti-CD11a-Biotin antibody produced in mouse clone MEM-25, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700380 Monoclonal Anti-CD11a-FITC antibody produced in mouse clone MEM-25, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700580 Monoclonal Anti-CD11a-FITC antibody produced in rat clone M17/4, purified immunoglobulin, buffered aqueous solution mouse
flow cytometry pricing
SAB4700381 Monoclonal Anti-CD11a-PE antibody produced in mouse clone MEM-25, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114380 Rosetta Predictions human pricing
NM_002209 Rosetta Predictions human pricing
NM_001033998 Rosetta Predictions rat pricing
NM_008400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326544 predicted 866
2 SASI_Hs02_00326545 predicted 1871
3 SASI_Hs02_00326546 predicted 2477
4 SASI_Hs02_00326547 predicted 2492
5 SASI_Hs02_00326548 predicted 1834
6 SASI_Hs02_00326549 predicted 1839
7 SASI_Hs02_00326550 predicted 3102
8 SASI_Hs02_00326551 predicted 910
9 SASI_Hs02_00326552 predicted 2605
10 SASI_Hs02_00326553 predicted 1934
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333433 predicted 1116
2 SASI_Hs01_00088339 predicted 2121
3 SASI_Hs01_00088336 predicted 2727
4 SASI_Hs01_00088337 predicted 2745
5 SASI_Hs01_00088338 predicted 2082
6 SASI_Hs02_00333434 predicted 2087
7 SASI_Hs01_00088341 predicted 3352
8 SASI_Hs01_00088342 predicted 1166
9 SASI_Hs01_00088343 predicted 2856
10 SASI_Hs02_00333435 predicted 2189
11 SASI_Hs01_00088334 predicted 2782
12 SASI_Hs01_00088335 predicted 350
13 SASI_Hs01_00088340 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117862 predicted 2621
2 SASI_Rn01_00117863 predicted 514
3 SASI_Rn01_00117864 predicted 1718
4 SASI_Rn02_00203871 predicted 1388
5 SASI_Rn01_00117866 predicted 2894
6 SASI_Rn01_00117867 predicted 1879
7 SASI_Rn02_00203872 predicted 3544
8 SASI_Rn01_00117869 predicted 757
9 SASI_Rn01_00117870 predicted 3397
10 SASI_Rn01_00117871 predicted 2501
11 SASI_Rn01_00117865 predicted 2856
12 SASI_Rn01_00117868 predicted 3543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097307 predicted 1105
2 SASI_Mm01_00097309 predicted 2999
3 SASI_Mm01_00097308 predicted 1680
4 SASI_Mm01_00097310 predicted 373
5 SASI_Mm02_00313833 predicted 2893
6 SASI_Mm01_00097312 predicted 723
7 SASI_Mm01_00097314 predicted 2422
8 SASI_Mm01_00097315 predicted 314
9 SASI_Mm01_00097313 predicted 1761
10 SASI_Mm02_00313834 predicted 3221
11 SASI_Mm01_00097311 predicted 2833
12 SASI_Mm01_00097316 predicted 2987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002209
ITGAL MISSION shRNA Bacterial Glycerol Stock
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-3055s21c1
Sequence:CCGGCCATCCACGACCACAACATACCTCGAGGTATGTTGTGGTCGTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-1128s21c1
Sequence:CCGGGAGAAGCTGAAAGATCTATTCCTCGAGGAATAGATCTTTCAGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-339s1c1
Sequence:CCGGCCCTGAGAGGTTCCAACTATACTCGAGTATAGTTGGAACCTCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-1069s1c1
Sequence:CCGGGCAGAAGAAGATCTATGTCATCTCGAGATGACATAGATCTTCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-3334s1c1
Sequence:CCGGCGTGGTGTATGAGAAGCAGATCTCGAGATCTGCTTCTCATACACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-2258s1c1
Sequence:CCGGCCCATCAATGTTTCCCTGAATCTCGAGATTCAGGGAAACATTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-2773s1c1
Sequence:CCGGCGCCAATGTGACCTGTAACAACTCGAGTTGTTACAGGTCACATTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-871s21c1
Sequence:CCGGATACCTTTGGTGCCATCAATTCTCGAGAATTGATGGCACCAAAGGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002209
ITGAL MISSION shRNA shRNA Plasmid DNA
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-3055s21c1
Sequence:CCGGCCATCCACGACCACAACATACCTCGAGGTATGTTGTGGTCGTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-1128s21c1
Sequence:CCGGGAGAAGCTGAAAGATCTATTCCTCGAGGAATAGATCTTTCAGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-339s1c1
Sequence:CCGGCCCTGAGAGGTTCCAACTATACTCGAGTATAGTTGGAACCTCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-1069s1c1
Sequence:CCGGGCAGAAGAAGATCTATGTCATCTCGAGATGACATAGATCTTCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-3334s1c1
Sequence:CCGGCGTGGTGTATGAGAAGCAGATCTCGAGATCTGCTTCTCATACACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-2258s1c1
Sequence:CCGGCCCATCAATGTTTCCCTGAATCTCGAGATTCAGGGAAACATTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-2773s1c1
Sequence:CCGGCGCCAATGTGACCTGTAACAACTCGAGTTGTTACAGGTCACATTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-871s21c1
Sequence:CCGGATACCTTTGGTGCCATCAATTCTCGAGAATTGATGGCACCAAAGGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002209
ITGAL MISSION shRNA Lentiviral Transduction Particles
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-3055s21c1
Sequence:CCGGCCATCCACGACCACAACATACCTCGAGGTATGTTGTGGTCGTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-1128s21c1
Sequence:CCGGGAGAAGCTGAAAGATCTATTCCTCGAGGAATAGATCTTTCAGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-339s1c1
Sequence:CCGGCCCTGAGAGGTTCCAACTATACTCGAGTATAGTTGGAACCTCTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-1069s1c1
Sequence:CCGGGCAGAAGAAGATCTATGTCATCTCGAGATGACATAGATCTTCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-3334s1c1
Sequence:CCGGCGTGGTGTATGAGAAGCAGATCTCGAGATCTGCTTCTCATACACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-2258s1c1
Sequence:CCGGCCCATCAATGTTTCCCTGAATCTCGAGATTCAGGGAAACATTGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002209.1-2773s1c1
Sequence:CCGGCGCCAATGTGACCTGTAACAACTCGAGTTGTTACAGGTCACATTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002209.2-871s21c1
Sequence:CCGGATACCTTTGGTGCCATCAATTCTCGAGAATTGATGGCACCAAAGGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008400
ITGAL MISSION shRNA Bacterial Glycerol Stock
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2223s1c1
Sequence:CCGGCCTATCAATGTCTCCCTGAATCTCGAGATTCAGGGAGACATTGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-729s1c1
Sequence:CCGGCCCATGTTCTTGCTGACCAATCTCGAGATTGGTCAGCAAGAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2300s1c1
Sequence:CCGGGCCTATCCTGAGACCTTCAATCTCGAGATTGAAGGTCTCAGGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2807s1c1
Sequence:CCGGCCCTGTCAACATCCTTACTAACTCGAGTTAGTAAGGATGTTGACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-820s1c1
Sequence:CCGGCCAAGGTGCTTGTCATCATTACTCGAGTAATGATGACAAGCACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008400
ITGAL MISSION shRNA shRNA Plasmid DNA
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2223s1c1
Sequence:CCGGCCTATCAATGTCTCCCTGAATCTCGAGATTCAGGGAGACATTGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-729s1c1
Sequence:CCGGCCCATGTTCTTGCTGACCAATCTCGAGATTGGTCAGCAAGAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2300s1c1
Sequence:CCGGGCCTATCCTGAGACCTTCAATCTCGAGATTGAAGGTCTCAGGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2807s1c1
Sequence:CCGGCCCTGTCAACATCCTTACTAACTCGAGTTAGTAAGGATGTTGACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-820s1c1
Sequence:CCGGCCAAGGTGCTTGTCATCATTACTCGAGTAATGATGACAAGCACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008400
ITGAL MISSION shRNA Lentiviral Transduction Particles
integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2223s1c1
Sequence:CCGGCCTATCAATGTCTCCCTGAATCTCGAGATTCAGGGAGACATTGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-729s1c1
Sequence:CCGGCCCATGTTCTTGCTGACCAATCTCGAGATTGGTCAGCAAGAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2300s1c1
Sequence:CCGGGCCTATCCTGAGACCTTCAATCTCGAGATTGAAGGTCTCAGGATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-2807s1c1
Sequence:CCGGCCCTGTCAACATCCTTACTAACTCGAGTTAGTAAGGATGTTGACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008400.1-820s1c1
Sequence:CCGGCCAAGGTGCTTGTCATCATTACTCGAGTAATGATGACAAGCACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)