EMAIL THIS PAGE TO A FRIEND

ITGAM

integrin, alpha M (complement component 3 receptor 3 subunit)

122 Gene Product Result for
Synonyms: CD11B CR3A MAC-1 MAC1A MO1A SLEB6
UniProtKB ID: P11215, Q4VAK0, Q4VAK1, Q4VAK2
Gene ID:
Human(3684) Summary: This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(16409) integrin alpha M
Rat(25021) integrin, alpha M
Horse(100064803) integrin, alpha M (complement component 3 receptor 3 subunit)
cow(407124) integrin, alpha M (complement component 3 receptor 3 subunit)
domestic cat(101087957) integrin, alpha M (complement component 3 receptor 3 subunit)
dog(489928) integrin, alpha M (complement component 3 receptor 3 subunit)
domestic guinea pig(100135561) integrin, alpha M (complement component 3 receptor 3 subunit)
naked mole-rat(101719288) integrin, alpha M (complement component 3 receptor 3 subunit)
sheep(443217) integrin, alpha M (complement component 3 receptor 3 subunit)
Domestic Rabbit(100351865) integrin, alpha M (complement component 3 receptor 3 subunit)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305652 ANTI-CD11B(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB2500547 Anti-ITGAM antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry pricing
HPA002274 Anti-ITGAM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
C0551 Monoclonal Anti-CD11b antibody produced in mouse clone ICRF44, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700386 Monoclonal Anti-CD11b antibody produced in mouse clone MEM-174, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700384 Monoclonal Anti-CD11b azide free antibody produced in mouse clone MEM-170, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700385 Monoclonal Anti-CD11b azide free antibody produced in mouse clone MEM-174, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700581 Monoclonal Anti-CD11b, low endotoxin antibody produced in rat clone M1/70, purified immunoglobulin, buffered aqueous solution nonhuman primates, mouse, human
flow cytometry pricing
SAB4700387 Monoclonal Anti-CD11b-Biotin antibody produced in mouse clone MEM-174, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700388 Monoclonal Anti-CD11b-FITC antibody produced in mouse clone MEM-174, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
F2648 Monoclonal Anti-CD11b−FITC antibody produced in mouse clone ICRF44, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700582 Monoclonal Anti-CD11b-FITC antibody produced in rat clone M1/70, purified immunoglobulin, buffered aqueous solution human, nonhuman primates, mouse
flow cytometry pricing
SAB4700389 Monoclonal Anti-CD11b-PE antibody produced in mouse clone MEM-174, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
SAB4700583 Monoclonal Anti-CD11b-PE antibody produced in rat clone M1/70, purified immunoglobulin, buffered aqueous solution nonhuman primates, mouse, human
flow cytometry pricing
AMAB90911 Monoclonal Anti-ITGAM antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL1719, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1402826 Monoclonal Anti-ITGAM antibody produced in mouse clone 4E10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
CBL1313 Anti-CD11b Antibody, clone M1/70.15.1 Anti-CD11b Antibody, clone M1/70.15.1 detects level of CD11b & has been published & validated for use in FC, IF & IP. pricing
MAB1387Z Anti-CD11b Antibody, clone M1/70.15.1, azide free Anti-CD11b Antibody, clone M1/70.15.1, azide free is an antibody against CD11b for use in FC, IF, IH & IP. pricing
MABF366 Anti-CD11b Antibody (human/mouse), APC, clone M1/70 This Rat Monoclonal Antibody Anti-CD11b (human/mouse), APC, clone M1/70, Cat. No. MABF366 is validated for use in IP, IHC, FC, IF for the detection of CD11b. pricing
MABF520 Anti-CD11b Antibody (human/mouse), APC, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), APC & clone M1/70 validated for use in IP;IHC;Flow Cytometry;Immunofluorescence for the detection of CD11b. pricing
MABF362 Anti-CD11b Antibody (human/mouse), APC-Cy7, clone M1/70 This Rat Monoclonal Antibody Anti-CD11b (human/mouse), APC-Cy7, clone M1/70, Cat. No. MABF362 is validated for use in IP, IHC, FC, IF for the detection of CD11b. pricing
MABF512 Anti-CD11b Antibody (human/mouse), APC-Cy7, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), APC-Cy7, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF363 Anti-CD11b Antibody (human/mouse), Biotin, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), Biotin, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF513 Anti-CD11b Antibody (human/mouse), Biotin, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), Biotin, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF514 Anti-CD11b Antibody (human/mouse), Biotin, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), Biotin, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF364 Anti-CD11b Antibody (human/mouse), PE-Cy5, clone M1/70 This Rat Monoclonal Antibody Anti-CD11b (human/mouse), PE-Cy5, clone M1/70, Cat. No. MABF364 is validated for use in IP, IHC, FC, IF for the detection of CD11b. pricing
MABF515 Anti-CD11b Antibody (human/mouse), PE-Cy5, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), PE-Cy5, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF365 Anti-CD11b Antibody (human/mouse), PE-Cy7, clone M1/70 This Rat Monoclonal Antibody Anti-CD11b (human/mouse), PE-Cy7, clone M1/70, Cat. No. MABF365 is validated for use in IP, IHC, FC, IF for the detection of CD11b. pricing
MABF516 Anti-CD11b Antibody (human/mouse), PE-Cy7, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), PE-Cy7, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF359 Anti-CD11b Antibody (human/mouse), PerCP-Cy5.5, clone M1/70 This Rat Monoclonal Antibody Anti-CD11b (human/mouse), PerCP-Cy5.5, clone M1/70, Cat. No. MABF359 is validated for use in IP, IHC, FC, IF, FC for the detection of CD11b. pricing
MABF517 Anti-CD11b Antibody (human/mouse), PerCP-Cy5.5, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), PerCP-Cy5.5, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF518 Anti-CD11b Antibody (human/mouse), violetFluor™ 450, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), violetFluor 450, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF519 Anti-CD11b Antibody (human/mouse), violetFluor™ 450, clone M1/70 This rat monoclonal antibody Anti-CD11b (human/mouse), violetFluor 450, clone M1/70 validated for use in IP, IHC, Flow Cytometry & Immunofluorescence for the detection of CD11b. pricing
MABF80A Anti-CD11b, (human/mouse), FITC, clone M1/70 Antibody This rat monoclonal Anti-CD11b, Antibody (human/mouse), FITC, clone M1/70, Cat. No. MABF800 is validated for use in Flow Cytometry, for the detection of CD11b. pricing
MABF80B Anti-CD11b, (human/mouse), redFluor™ 710, clone M1/70 Antibody This rat monoclonal Anti-CD11b Antibody, (human/mouse), redFluor™ 710, clone M1/70, Cat. No. MABF804 is validated for use in Flow Cytometry, for the detection of CD11b. pricing
MABF370 Anti-CD11c Antibody (human), clone 3.9 This Mouse Monoclonal Antibody Anti-CD11c (human), clone 3.9, Cat. No. MABF370 is validated for use in Immunoprecipitation, Immunofluorescence, Flow Cytometry for the detection of CD11c. pricing
MABF369 Anti-CD11c Antibody (human), PE-Cy7, clone 3.9 This Mouse Monoclonal Antibody Anti-CD11c (human), PE-Cy7, clone 3.9, Cat. No. MABF369 is validated for use in IP, IF, FC for the detection of CD11c. pricing
MAB16983Z Anti-Integrin α4 Antibody, clone P1H4, azide free Anti-Integrin α4 Antibody, clone P1H4, azide free is an antibody against Integrin α4 for use in ELISA, FC, IC, IH & IP. pricing
CBL1512 Anti-Integrin αM [CD11b] Antibody, clone OX-42 Detect Integrin αM [CD11b] using this Anti-Integrin αM CD11b Antibody, clone OX-42 validated for use in FC, IH, IH(P) & IP. pricing
CBL1512Z Anti-Integrin αM [CD11b] Antibody, clone OX-42 Detect Integrin αM [CD11b] using this Anti-Integrin αM CD11b Antibody, clone OX-42 validated for use in FC, IH, IH(P) & IP. pricing
CBL1512F Anti-Integrin αM [CD11b] Antibody, clone OX-42, FITC conjugated This Anti-Integrin αM CD11b Antibody, clone OX-42, FITC conjugated is validated for use in FC, IH for the detection of Integrin αM [CD11b]. pricing
MAB19101 Anti-Tenascin Antibody, clone DB7 Detect Tenascin using this Anti-Tenascin Antibody, clone DB7 validated for use in IF, WB, IH(P). pricing
MAB1908 Anti-Tenascin Antibody, NT region, clone α-K Anti-Tenascin Antibody, N-terminus region, clone α-K detects level of Tenascin & has been published & validated for use in WB, IH. pricing
MAB1909 Anti-Tenascin Antibody, type III B domain, clone α14-B Anti-Tenascin Antibody, type III B domain, clone α14-B is an antibody against Tenascin for use in WB, IH. pricing
MAB1911 Anti-Tenascin Antibody, type III repeats 1-3, clone 9F8 This Anti-Tenascin Antibody, type III repeats 1-3, clone 9F8 is validated for use in ELISA, WB, IC, IH for the detection of Tenascin. pricing
MAB1923 Anti-Tenascin Antibody, type III repeats 4 and 5, clone 4F8 Detect Tenascin using this Anti-Tenascin Antibody, type III repeats 4 & 5, clone 4F8 validated for use in ELISA, WB & IC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000632 Rosetta Predictions human pricing
NM_012711 Rosetta Predictions rat pricing
NM_001082960 Rosetta Predictions mouse pricing
NM_008401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188431 predicted 251
2 SASI_Hs01_00188432 predicted 3297
3 SASI_Hs01_00188433 predicted 2092
4 SASI_Hs01_00188434 predicted 665
5 SASI_Hs01_00188436 predicted 2146
6 SASI_Hs01_00188437 predicted 2724
7 SASI_Hs02_00302979 predicted 1208
8 SASI_Hs01_00188438 predicted 829
9 SASI_Hs01_00188439 predicted 1283
10 SASI_Hs02_00302980 predicted 618
11 SASI_Hs01_00188435 predicted 3256
12 SASI_Hs01_00188440 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105724 predicted 2608
2 SASI_Rn01_00105725 predicted 444
3 SASI_Rn01_00105726 predicted 904
4 SASI_Rn01_00105727 predicted 2734
5 SASI_Rn01_00105728 predicted 2347
6 SASI_Rn01_00105729 predicted 573
7 SASI_Rn01_00105730 predicted 1199
8 SASI_Rn01_00105731 predicted 828
9 SASI_Rn02_00260036 predicted 2582
10 SASI_Rn01_00105732 predicted 2451
11 SASI_Rn01_00105723 predicted 3219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299385 predicted 2717
2 SASI_Mm02_00299386 predicted 3124
3 SASI_Mm02_00299387 predicted 3389
4 SASI_Mm02_00299388 predicted 2697
5 SASI_Mm02_00299389 predicted 2613
6 SASI_Mm02_00299390 predicted 2013
7 SASI_Mm02_00299391 predicted 1237
8 SASI_Mm02_00299392 predicted 2753
9 SASI_Mm02_00299393 predicted 1376
10 SASI_Mm02_00299394 predicted 2901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150525 predicted 2720
2 SASI_Mm02_00313835 predicted 3123
3 SASI_Mm01_00150526 predicted 3378
4 SASI_Mm01_00150527 predicted 2694
5 SASI_Mm01_00150528 predicted 2610
6 SASI_Mm01_00150529 predicted 2009
7 SASI_Mm01_00150530 predicted 1230
8 SASI_Mm02_00313836 predicted 2745
9 SASI_Mm02_00313837 predicted 1376
10 SASI_Mm02_00313838 predicted 2899
11 SASI_Mm01_00150524 predicted 2593
12 SASI_Mm01_00150531 predicted 2605
13 SASI_Mm01_00150532 predicted 3887
14 SASI_Mm01_00150533 predicted 3835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000632
ITGAM MISSION shRNA Bacterial Glycerol Stock
integrin, alpha M (complement component 3 receptor 3 subunit)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-663s1c1
Sequence:CCGGCCGGATTCACTTTACCTTCAACTCGAGTTGAAGGTAAAGTGAATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-144s1c1
Sequence:CCGGCGCAATGACCTTCCAAGAGAACTCGAGTTCTCTTGGAAGGTCATTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-2704s1c1
Sequence:CCGGGTCACCTTTAATATCACGTTTCTCGAGAAACGTGATATTAAAGGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-3225s1c1
Sequence:CCGGCCTCTCGTTTGACTGGTACATCTCGAGATGTACCAGTCAAACGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-2142s1c1
Sequence:CCGGCGTCTTCAATGAGACAAAGAACTCGAGTTCTTTGTCTCATTGAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-1164s21c1
Sequence:CCGGAGCGCTGCCATCACCTCTAATCTCGAGATTAGAGGTGATGGCAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-619s21c1
Sequence:CCGGCAACTGTGATGGAGCAATTAACTCGAGTTAATTGCTCCATCACAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-2240s21c1
Sequence:CCGGGAAACTACAGTTGCCGAATTGCTCGAGCAATTCGGCAACTGTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000632
ITGAM MISSION shRNA shRNA Plasmid DNA
integrin, alpha M (complement component 3 receptor 3 subunit)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-663s1c1
Sequence:CCGGCCGGATTCACTTTACCTTCAACTCGAGTTGAAGGTAAAGTGAATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-144s1c1
Sequence:CCGGCGCAATGACCTTCCAAGAGAACTCGAGTTCTCTTGGAAGGTCATTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-2704s1c1
Sequence:CCGGGTCACCTTTAATATCACGTTTCTCGAGAAACGTGATATTAAAGGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-3225s1c1
Sequence:CCGGCCTCTCGTTTGACTGGTACATCTCGAGATGTACCAGTCAAACGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-2142s1c1
Sequence:CCGGCGTCTTCAATGAGACAAAGAACTCGAGTTCTTTGTCTCATTGAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-1164s21c1
Sequence:CCGGAGCGCTGCCATCACCTCTAATCTCGAGATTAGAGGTGATGGCAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-619s21c1
Sequence:CCGGCAACTGTGATGGAGCAATTAACTCGAGTTAATTGCTCCATCACAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-2240s21c1
Sequence:CCGGGAAACTACAGTTGCCGAATTGCTCGAGCAATTCGGCAACTGTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000632
ITGAM MISSION shRNA Lentiviral Transduction Particles
integrin, alpha M (complement component 3 receptor 3 subunit)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-663s1c1
Sequence:CCGGCCGGATTCACTTTACCTTCAACTCGAGTTGAAGGTAAAGTGAATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-144s1c1
Sequence:CCGGCGCAATGACCTTCCAAGAGAACTCGAGTTCTCTTGGAAGGTCATTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-2704s1c1
Sequence:CCGGGTCACCTTTAATATCACGTTTCTCGAGAAACGTGATATTAAAGGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-3225s1c1
Sequence:CCGGCCTCTCGTTTGACTGGTACATCTCGAGATGTACCAGTCAAACGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000632.2-2142s1c1
Sequence:CCGGCGTCTTCAATGAGACAAAGAACTCGAGTTCTTTGTCTCATTGAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-1164s21c1
Sequence:CCGGAGCGCTGCCATCACCTCTAATCTCGAGATTAGAGGTGATGGCAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-619s21c1
Sequence:CCGGCAACTGTGATGGAGCAATTAACTCGAGTTAATTGCTCCATCACAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000632.3-2240s21c1
Sequence:CCGGGAAACTACAGTTGCCGAATTGCTCGAGCAATTCGGCAACTGTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008401
ITGAM MISSION shRNA Bacterial Glycerol Stock
integrin, alpha M (complement component 3 receptor 3 subunit)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-1922s1c1
Sequence:CCGGGCAGCCAGATTGGCTCTTATTCTCGAGAATAAGAGCCAATCTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-607s1c1
Sequence:CCGGGCCTTGTGTCATGGCTTCAATCTCGAGATTGAAGCCATGACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-1710s1c1
Sequence:CCGGCCTGTATACATCGAAGGATAACTCGAGTTATCCTTCGATGTATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-3792s1c1
Sequence:CCGGCCTGTTTAATGACTCTGCGTTCTCGAGAACGCAGAGTCATTAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-2767s1c1
Sequence:CCGGCGCCTCAATTATACACTGGTTCTCGAGAACCAGTGTATAATTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008401
ITGAM MISSION shRNA shRNA Plasmid DNA
integrin, alpha M (complement component 3 receptor 3 subunit)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-1922s1c1
Sequence:CCGGGCAGCCAGATTGGCTCTTATTCTCGAGAATAAGAGCCAATCTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-607s1c1
Sequence:CCGGGCCTTGTGTCATGGCTTCAATCTCGAGATTGAAGCCATGACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-1710s1c1
Sequence:CCGGCCTGTATACATCGAAGGATAACTCGAGTTATCCTTCGATGTATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-3792s1c1
Sequence:CCGGCCTGTTTAATGACTCTGCGTTCTCGAGAACGCAGAGTCATTAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-2767s1c1
Sequence:CCGGCGCCTCAATTATACACTGGTTCTCGAGAACCAGTGTATAATTGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008401
ITGAM MISSION shRNA Lentiviral Transduction Particles
integrin, alpha M (complement component 3 receptor 3 subunit)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-1922s1c1
Sequence:CCGGGCAGCCAGATTGGCTCTTATTCTCGAGAATAAGAGCCAATCTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-607s1c1
Sequence:CCGGGCCTTGTGTCATGGCTTCAATCTCGAGATTGAAGCCATGACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-1710s1c1
Sequence:CCGGCCTGTATACATCGAAGGATAACTCGAGTTATCCTTCGATGTATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-3792s1c1
Sequence:CCGGCCTGTTTAATGACTCTGCGTTCTCGAGAACGCAGAGTCATTAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008401.1-2767s1c1
Sequence:CCGGCGCCTCAATTATACACTGGTTCTCGAGAACCAGTGTATAATTGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)